Description :
From Genome Similarity Track
Location :
Scaffold_1023:5530- 7345
Sequence
1815 bases(100 bases per row)
ACATCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTC
GTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAACGCATAAAGTCGG
CGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCAT
TGCCTCGTGACCCAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGTTCGGTGGGTGTTTGTTCACCACGT
CCGCATACTCGGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGAC
GTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTCCAGCCTTGAGGTTGGCCAGG
AAAGACTCAGCCGTCATTTCCTCGAGGTTCAGTATCTCCGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCTCGC
CATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCGG
ATCCGACTTGAGGCGGCGGAGGTGTCCTTGCCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGACATCCGAGGCA
CTCGTGGCCTCGTGTGATACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTAC
CCACACAGGAAGCGTATCCGACGTCTTCTTCTTCAGTTAAGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTT
CATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTATCCACTTGGCCAGCGCCTCTTCTGGGCGCGGCCACCATCAAAACA
TCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGAATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGG
GAACATGACTCACCAATGCTCTGTCGGACTGGCGCAGGGGCGGCGGGCCACGCATTTTCTCTTTTTCGCGCCAGTACATTCCCGAGGTTCTGTTTTTTTT
CCAACCCGGGACCTGCCCGAGAATCATTTTCTTTAGGATCCATTTTCGAGACACAGGGAAATTTTTGGAGGCTTTACAAATTTTTAGACTTTCAAAGTCT
TCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGTCAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCA
AAGCTTCGGACAACTTGTTGCTGTCACGAGCAACCGTCTGGCGGCGTGCGAAATGCTTCGACGCCCTAGAGTCAATCAAGATTCTAAAGGGATGATCGTA
TCCCCGTACACCGTGTACTACGAGCAACCCGCCGTTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCC
GCGCACCCATCACGA