Description :
From Genome Similarity Track
Location :
Scaffold_518:553- 3951
Sequence
3398 bases(100 bases per row)
GACCTTCTCAGGATCTGCTCGGACACCATTTTTGCTCACATAACAGCCAAGCACCGGAATCTCCGGGGCACAGAAGATGCATTTCTTCAAGTTCGCGTAC
AGTTTGTTTTCGCGCATGACTTGGAACACTTGTCGTAAGTGATTTAAGTGAACTTCTGTGGCGCTGAGATCGCCCTCAGCGCGGCTGTGAACGAAGATGT
CATCGAAGTAGCTCGAAGCGAAGTCGCGAAGTGGGCGCAGAACGTGGGAAACCATGCGATTGAACGTGGCTGGTGCGTTTTTCAGGCCCTGTGGCATGAC
AAGCCACTCCCAAAGCATCCCGCTGGGAGTGCTCACCGCTGTGAGCGGGACGTCGCTGAGTCGCATCAAGATCTGATAGAAGCCATCGGTCAGGTCGATG
GTGCTGAAAATAACACTGCGGCCCATGGTGTCAAGTACCATATCCTTCCGAGGGATCGGCGTTTGTGCTGGAATGGTGGCGTCGTTTAGCTTGTTAAAAG
CGTGAACAATGCGCCAACCACCCGTGGCCTTCTTCACGCAGAACGTCGGACTCGAGTGTGGCGAGGTACTCTCGCGCACGTGACCCGCTTTGCGGCGGCT
CTCGAAGAAGTCGTCAATGGCTTTAACCTGATCGCGTGGGAGGGGCCACTGTCGCATCACACAATACTTGGAACCCGGCGTGAGATCAATCTCATGGCGA
ATGCCTCTGTTAGCAGGGAGCTCAGCTGGAATCTTGTCGGGAAAAACATCCGCGAACTCGCGGACGGTGTCGTATACTGGATTGCCCGAGTCGCGGAGTG
ACTCCCACGACTGGGCAGCGAAGCGCTCTTCGCGCGCCGACTTCGGCTCAGCGTTCTTTGGACGAAGTGGAAGATTGTCGGTAGCGACCGTGTGGATCTC
TTCCGCCGAGGCAGACTCGGTGATCAAGCAGACCTGCTCGATGTCTCCTGACTTCAGATCGCGCAGAAAATGCTTCCAGGAAAGACCCGGAAGGCGTGTG
ATGGAAGAAGCTTCGCGAGGTGGGCTCTCAATGTCAAGTGTGCGTGAGCGAACGGCGCCTCCTTCCACGTGTTCCAGGACGTGTATGGGACTCATTCACT
GCGATATCGGCGGTGGGCTGACCACGTCGCTTAAGACGGCGTCGCTTGGATTTCTTCTTGTGGCGTCTCGAGCCGCTGCTCGAGACAGAAGACTCGCTAT
CGCTGGACGAGGGATCACCCCCCTCTAGACACGGGAGGACACCATCAACCGTGTCGGTAGTGCGCGGGAGCTCTCGATGCTCGACCGCGCCATCGACTGG
AGGGAGCCCCTGCTCGATCGCCGTCGTAGCCGGTGGGGGTGTCAACTGCTCGACCACCGCTGTGGATGACGGGAGCTCCAACTGCTCGACCGCCGAATCG
CGTTGCGGGAACCTCTGCTCAACCGCTAGAGTGTATTGCGGGAACTCATGCTCGACCGCCGTGTTGCGTGACGGGAACCCATGCTCGACCGTCGTGTTGC
GTGACGGGAACCCATGCTCGACCGTCGTGTTGCGTGACGGGAACCCATGCTCGACCGCCGTGTTACGTGGCGGGAACCCATGCTCGACCGCCTGCTTGGA
TTGCGGGAGCCCCTGCTCTACCGCCAAAGTGTTAACAACCTCGCTTCGCAGCGAGGGGTTCTCGCGCAACAGCGCTGTGCAAGACATACAGAGAGGGCCA
TCGCTCGCTCTCAGCTCAACCTGCATTGTGGACAACCGGTCCACAACCCTGACATGGAGCCAGTCTTTCTGGGCAACCAGGAGGTGCGTGAACACCTCAC
TCACATCGAAGCCAGAGCGGTGTTTAACCGACCGAGCCAACCAGTCAATCTCTGGTTGATATCGTGACAACCACGGGATACCCAAGATGCAGTCGAACGC
GTAGTTCATCTCAATCACGAGGAAGTCGTCGTTGCTGCGGAAGCCGTCGAATGTGTATGGCAACGTGATCTCGCGCCGCGCAACGCGGCGTGGCTTTCCG
TCTGCAAGTTTGACGACGACCTGACCTCGACCATTACGGACTGCGATCTCTCTTGGAAGCATCGATAAGCACGATTCGCGAAAGAAGTTATTCGATGCTC
CTGAGTCCAGGAGTGCGCGAAGTGGTCGCCGGGCGCCGGCGACATGAAGACTGACGATGATCAGCCTCGAGTCGCCCGACGTGGTGGTGGCATTAAAGTA
AGCGTGGAGCACAGGAGGGCTAGAAGGTTGGGTAGCCACCGGGGGGCCCGGACCTCCATTCCAGCCAGTAGGGCCCCGCACCTACTGACCCTGACCATTT
TTTGACTGAACGGCAGGTGAGACTTCAGCGGTGTGCGCGAGTACCGGCGCTGGCGCGCGGCATTCCGCCGCGCGATGACCGATCTTCCGGCAGCGGAAGC
AAGTGAGGGGCGATTGGGACGGCCGTTGGGCCCACGAGAAGTCGACTGACGATGATTATTTGATGCGTCAATCGCGTCGATCTCCATGGGCTCGGGGGCT
GACTCACGAGCTGCCGTTGACATCGCGCGCGCGTAAGACGCCGCCACATCGTAGTCTTCGCGTAACGCGAGGGCGAATGCTTCCTCGAGAGAGGAAGGTT
CCGCTCGGGTCAGGCGGTACCGTGTCATGCCTTCACGCATGCCGAATACGAATACATGGACCTGCGATGCTGCGTCAATCGGATTTGTCACGATGCATGA
CGCGAGGTGGCGAGTCTTTTGAACGTAGTCGCGCATAGTCATTTTGCCTTGACGAAGGGCGAGGAACTCGGCACGCACGCGGGATTCGTCTTGAGGTGGC
TCGACCGCGAGCCTGAGATCTTTCTGGAGAGACCCCAGAGTGGGGAATGCGTCGTGATCAACGACAAGTTTACCGAGGGCCCATTCATTGGCCTTCCCGG
ACAACCGGGACAATAAGAAATTGACCTTTGTCCCTTGCGCTTCGATCATTCTCGAAGCAATCGCGATGTCGACCTCGCGAAACCACCGGTTCAGCGGGAG
GCGATTCGCTCCTTCACCGGAGTAGGTAGACGTCTCTAGCTTCACGACATCATTTTTCGAGGAACGCGCGAGAGTTGTTGCTCGCCGATTCGCATCGGCT
AGCTCGCGTTCCATGAACACTTGGGCTGCTTGGCGTTGTTGGTCGGACGTCGCTGAGCTCAGCAGCGACGCGATTACAGCCTCACCAGACACCGCCGCGA
GGCGGTGAAGGGCTTCCCACTCGACACGAGTGAGATGAGGGAAAGCAGCATGTTCCAGAGTCGGCCCTGGAGTTTCAGACGTCATACCTTGGCTCATCGT
GAACTTGGTCATAGGAAGGACTACAAAGTGCTACCAGGTGTAACGGGCCTGGGGTGTCCGTTACTTGCTTACACGTAGTGATGAGGAAGCGTACAAGT