Description :
From Genome Similarity Track
Location :
scaffold_1777:553- 2794
Transcript NameFunction/comments
Pl_100346pol protein

Sequence
2241 bases(100 bases per row)
TGCTGACTCTTCCCGAAAGAACTTGATCCTAGCTGAGAGTTGAGCTCGGGCGAAGGCCGCCAAGGAGGCTGCGACTTCTAAAGCGGTTGCAGAAGGTGCC
GCCGCTAAGAAGCGCGCGATTCAAGCTCTCCTCGTCGAGATTCGACAGATAGCAAAGGATATCGGAGCTTGTTTGATGCAAGCTCTGATTCTGAAGAGGA
GGGACTGTACACGATCCCCGTGAGATCACGAATGATCTCAATGGGATGCAAGAGCGATTCTGTGCTGCTCAGGCGCAAGCTCTCGCTGAGATTGCGCCCC
CAGCCCCTAGTACAACTTCATACCCTAAAGGCTATTACCCGCCCGACACGGGTCCGGGCTCTCATTTGTTTCTGGAGAAGCTCCGAGCTCCTCGTGGTCT
AATCCACGGCCGCACCTCTCGGGGGGCCTATGAACGAGCCTTCATTCGAAATGATCGGCTCTTCACCGAAGATATTGAGGCGGTTCGATGTGTGGTGCTA
GCAGCACATCGAACTCCTCTGAAGGAGTTCATCAGCCTCCGCAAGAAGTCGGAGGACCGTGGTGGACTCTTTCCGGTGTGTGGCTACTCTTGGGTACAAC
CCGCAAACACCACAACTCCTACACAGGCTGAGACCCTGTTCTGGAGATGGGTCTCTATGTAGAGCTACTCAGCTCAGGAGATGAACGAACTCCGTGAAGA
TCGCATGTTGTCCCACCTATTGGACCAGCGCGATCTTTGCATCGAGTTCGCGCACCTCATCGGCAAGCGCCAACTCCTTTCCGCAATGGGTAGACCGCTT
GGTCTGGCGCTCAAGATGAGCGCATGTACGGCATGTACTCTAGTGCCGTGCCCCGTAAGTCGGCTAAGAAGCCACGGACTACTTACGGAGCTGCCGTTAC
TTCTGGTCCCAGATCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCCGGTCTTCTGGCTCCCACGAGTTCTGTGATGGCGGATACTCTCGAATCCCCCCGC
CAAGATGTGGATGGTCTGGGCCGTAAGATCTGGGAGCTACATAGTTGTGTTGACCGTTGGGCTCCGGCTTCCGTCGTGAAGGACTTGCGCCGTGATTTTG
AGTATTTGAGTCGCGAGGTCCGCAACTAGGCTTCTTCTCGGGAGCCTCAAGGGTATGGGTATCACGCAACCTATGTGTTTGATTCGTATAGAGGTCCTTC
ACGTAGGACTCCTGCGTACACGGCGCACGAGCCGCGGTGATATCAATCTCCTTTCTCGTGCAGTCTTTGGCGACGTCAGTGCCGGTTGCCTCTGGAGCCT
CTCCTTGATTCGAAGAGGTAAGCTCAACTCTTCATAGACGTCATCTGCCTCCTGTCGAGGAGGAGGCCCAGCGGGTCATGATACCGCTTGAGACGGCCCA
CGTAGAACGCTGGTTGGGTTGCCATAGAGGTTGGCAAGGCTATCGTGTAGGCGGCCCCATGCCAGTCGAGGACCGCGAAGGGTCCGATGAAGCGATGCTT
CGGTTTGTTGCTCCCTACAGAGCTAACCAGCTTTAGTGGTAGAATTTTAGTATCAAGGAGCACTAACTCCCCAGCGTTAAACACGATCAAGTTTCCTCTT
CCTTTTGTGTCAGAGTACTCCTTTTGTTTGTTTTGGGTCGATGCAATTGCATCTCTAACCCGGCTGATAAGCACTAGCCTATTGTCAACAAACGTTAACA
GTTGTCGTTTGCAACGACTCTGTGTGAGGCAAGACCACAGCGCACCAACAAGTGCGGCGAAGGGAATCCCGCAAACAGGGCCAGCGCGGGGCCAGTACCC
ATGGAATTGGGTGCGGCCGAGTAAAGCTCCATCCGATGTTACGGATGTGGAAAGCTTGGGCACATGCAACGTACCTGCCCTGCTGGTGGGCAAGGGAAAT
TCTCTTCCGAATTTAAGGGCTCTAAGGGTCAGTGGCAGAAGCCACGACCTAAGCACCAGGGGAATGGGGACCACCAGTAGCCCTACTGGGGAAGATCTAA
GTCTTTGGAGAAGACGTGCGAACGGTGCATATCTCAGAGGCTTAGCCCCGGAGAGTCTTGGTGCTCTCGAATCGAGAAAGAGCAGCGGCGGGCAGCTGGT
AGTACACACGAGTGCACAGGGTTACGATCACCCCTTCCGAATCTTGATCGATTCAGGCTTGTCGAAGAACTTCGCACGCAGCCAGTCGGTCGCTCAGAAT
AGCAACAAGTTTGTCGATGCTCTGCGCGATAGCGAAGGCAA