Description :
From Genome Similarity Track
Location :
Scaffold_123:5529- 10476
Sequence
4947 bases(100 bases per row)
TGGTTCCTCGAAGTGGACGATGCCATTAAGGCTCGCCACATCGACGAAGAGGAAATACAAGTTGCATTTGCCAAATCGAATTTGTCGGGGCGTGCCAGAA
CTTGGGCCCTGAATCTTCAATTACACTATTCAAACATGTTTGAATCGTTGGCGGTCTTTAAGACTCTGCTCAGCCAAACGTTTGAGCCACCAAGAGCTGA
GTTCAGGACTCTTACAGAGCTCCTGAAGATAAAACAAGTTAAGCGTGACGTTCACGATTACGCTCAGAACGTTCGTTACCTTGCAAGTTGCATGGTAGCT
TATCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCTCATAGATGGTCCCGCTTGAGGAAGCGATCCCAACTGCGGTGCAAGAGGACTTTA
GTGTGAGACAGGCTCACACTAGCTTGACCCCCTATGATCCTTTGAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGCAGTGTCGAGAGCGA
GAGACCTCGTTTTTCAAGCAGTAAGCAATTGCAAAAGTACAATCGCTGTCAGAAGCTAGGACACTACGCCTACAAATGTAGTGCTTCACGCTCAGTGTCT
CGAAACACTGAGCGAAATGATCGATCGTCTGCCAAGAAGGGCAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTAGCGGACCGTCAAAAA
ACGGTCGGGGTCAGTAGGGGCGGAACGCCCTACTGATCCAGAAACCTCAATAGAATTTGCAAATTTATTGATGAAAGTTGCTCCAGAATCACAGTCCTTG
TGTGTCTCTGCACTTGGTGATGAGGTACCCCTCATCACCTTGAATTTAGAAGCGACAAAAAATTTGTCACTTCGTGCCTTAGTTGACCGTGGGGCATCGA
ACAACTTTGTTCGTCGCCAGTCGCTAGAGGATCGTAGGCTCAAGTTTGTTGAGCGCGTTACTCGTCCTACGAGGCTGGCTGTGCGCCTCGCAACAGACGC
ATGAATAGCAGTGATGAAGCGTGTAGTGGGATTTCACTACACGCTAGAAGATTTGCAGTAAAATGATGATTTCATCGTACTTGATTTGGATGACAAATTT
GATGTCATCTTAGGGTTACCCTGGCTCAGAAGGTACGATCCAAGGGTCAGCTGGCAGCATCGAACCGTGAAGATGCCTGCCACTTGTTCATCAGATGGCC
ATCCGATGAATGTCTTGGAGCGTCCACAAGCATGTGGATGTACTGTGAGTGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTCTAGGACTGCACAAGAT
CACAGTGTGACAACCAATCACACTGTGGAGTAAGCTGCCGGCGGCTGTGCGGATGCACAGGCAGCGCCGAAGGTCCACCACTCGAACAAGTCGAGTGGAT
AGGGACATGGGTGTACGACTAGCGGGCGACATCCAACTAAGAATAAATCGGTTGCCCACACAGGGCAACACGATGATCCTAGATCGACTGGAGAGTTGGT
CGTTGAAGACCTAGCTATGGTTGCGCTACCACAGCTAGAAGAAGTCGAGGGAATAAGCCCCCTGCATCCTGTGAAATAGGGTTCCCAGGAAGAACCGAGA
TATTGAATGTACTGGTTAATGACGGGTAACGTGTAGGCGATTATACACCTGATCTGATCGCGCCTCCGAAGTTGACTTCGGGGATCACTCAATTGCCAAC
CATAGAACCGAAACGGTTCTTGCGAGATCTGCGTGGTGGCAAAGTCAAGCAGATATGTGTACTCGTCGCGGAGGACGAGTACGTGACCAATTCTAGGTCA
GCAGTAATATTTGAAGACAACGAACGGGTTCTCAGCAGCTCATAAATAGACGAAAGTGTCCTCAATGAGAAGACATAGATTGAGAGATACACGTCTCAAT
CTTGGGAGTCGCTTCAGGCAAATACCTTATATAAGGATTTGATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATTCGAATTGCCTAAGGATAAAGG
CACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTGGCCACTACCTCGTGAACAAGTACTTGTGATCGACAAGCTCGAT
CGCTTAGCTGCGGGTCATGTGAGGGAGTCAACTCCCCCTCACAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGGATAGCGGATAGTGCACGCAT
TCAACAAGTTGAATGCTGCAACGGTACCGGCTCAGACGCCGATACCGAGGAAGGACGTAATCATTGATAGTATGTCAAAGAGTACTATCTTTTCGTCCAT
AAATCTGATGGGTGGCTTCTATCACATCCTAATGCGTGAACGGGACATCCCGTACACGGCCGTAAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTA
ATGCCACAAGGGCTTAGTAACGCCCCTGCCATCTTCAACAGATGTGTTACAAACCTGTTGAGACCGGTGCGAGACTTCGCACCGAATTACTTCGAAGATG
TATTTGTCCATAGCCGGCTATGGGCGGAAAGACGGACGTAGAGCTTCATAGAACTCGTTTGTCAGGTTCTTACACTTATGCGCAAGCATAATCTGTACGC
CAAACTCGAGAACTGTATATTCGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACGCCCTGATCCTGAAAAAATGAGGTCG
ATCACCGCCTGGCCTGTGCCAGTCGACGTTAAGGGACTAATAAAGTTTCTTGGTCTAGCGGCATACTTACACAAGTACTCGCACAAATACGCTGAGATGA
CCGTTCATCTCTCTCGTCTCTTGAAAACGAACAAGAAATGGTCATGGAACGCTGATTGTCAGCGTTCCTTTGAAGGTATCAAGCAGAGCTTGATGCAATC
GCCCATCTTGGCGATTGCAGACCAAGACATACCTTTCCATGTGGTCTGTGACGCCAGCGATTTCGCAATCGGCTGCGCGTTAATGCAGTACGATGCAGAC
GGCGCAGAGTGCGCCGTCTGTTATCAATCGTGTCAGCTGCAAGCAGCTGAGCGTTATTATCCAGTGTATGACAAGGAAGACCATGCCATGAAGTATGCGC
AAGCAAAGTTTCACGTCTATCTCCTCGGAGATAGGCAGTTTGAAGTCTATACGGATCATGCGTCATTACGCACGGCCGTAAACAGCCCACACCTCTCGCA
AAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAGTACAACTTCTCCGTAGAGGATAAACCCGGACGACGTAATGTCGTCGCGGACGCGTTGTCGCGCTGA
ACCGATTTCGATTCGGCTGCGCCGTCCACCAGTGAGGTTGATACTACTGTTGCAACACTAGTCACTAGTGTTCCATCATCAACATTGCTTGACGACATAA
AAAAGGCCTACGCAGAAGATAGGGCTCTTCTGCGACTAATGAATCATCTGGTGACTCCATCTCGTAAATCTCTCAAAGATTTACCGGCCTTCTATCGATC
TTCCGCAGATCGATACACAACACGCAACGGATTGCTGTATTATACAGCCGTTACCGGCGACACACCTCGTGTCTTCGTCCCCACTCATAATGATTTGCTC
TTACGCATCATGTATGAGTGTCACGATGCACCAACTAGTGGGCATCGTAGGCTTGAGAAGAATTATCTCACGGTAAGTCGCGACTTTTACCGGCCCCTCC
AGTATCAGTTTGTGCGCAATTACATTCGTGATTGTGAAGTGTGCCAACGAGTGAAGCCCAGTCCTTCATCCCGTGCGCCACTACAGCCTCTACCAATCCC
AAAAGAGTGCTGGCAGTCCGTTTCAATGGACTTCGTCTTCGATTTTCCCGAAGCCACTTACAAGAATAATGGTATTCTTGTGTTCGTAGACAGATTCAGC
AAGATGGTACATCTTGCTGCAGTTAATGAGTAAATCTCAGCACATGGTTGTGCCCGTATTTTCATTGACACGGTATTCCGACTCCACGGTCTACTCCATG
AACTAGGCTCTGATAGAGATCCTTGGTTTCACGGCGACGTTTTGGCAATCCGTGTTCCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATC
CCGAAAATGATCGTCAGACAGAACGCGTCAACCGCGTCCTCGAAGAGATACTTCGAGGATACGTCAAATATTTCACAGATTGGAGCGAATTTTTGTCGAT
TGTGGAGTTTGCAATTAACAACTCCGTGCATGCATCGAAACCGCATACACCACTCTTCGTGAATGGCTTACGCCATCCACGCCTACCCACCCATTTAGAG
TGTGACACTAATTCAAGGGGGGGAGGGATTCGCTCGAGCAAAAACCGTTCTGGCTCCTGCTCATCACGTGTCGAGGTAATCGACGACGCGAAAGTTGCTG
ATGTCGATCAAGTCGACATCGAAGAAGATAACCTTATCAATAGTGATGACACTATTGCTGACCCAGATGAGGATGACGATGCTGGTATATTCAGCATCGC
CAATGACTACACCAGCGAGGATGAGAACACTCTCGCTAAAAAAGATGATGATCTTCTAGCGGTGCGCACAAGGCGCACTGCAACAAACAAAAGTGATGCA
GCAGAAGATTTCCTGCTGGCACGAGAAGCAGTGGTCCGTTTTGTGCAAGACTCCATCGCTAACGCGGTGGAACGGTAGAATCGGAACGCTGACAAACATG
GAAGAGCAAACGTTCTTCTATTTAATGTTGGAGACTTAGTTCTACTATCTACGGTAAATCTACCTAAGCACGTAGTAACTAATGTGGGTAGTACTAAACT
TCTACCCAAGTACATCGGCCCGTTTCGTGTACTACATCGCAAAGTCAATGCGTACACGATCGAGTTGCCTCGCAGGATACGTACGCATCCTACGTTTTAT
GTCGGTCGTCACCGCCCGTACCATCACCACGAGGTCTCTTCCTCGGG