Description :
From Genome Similarity Track
Location :
Scaffold_824:5529- 9462
Sequence
3933 bases(100 bases per row)
TTCCCGACGCAGACGAGCTTGAGGAGGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAA
GGCTCCGACGCCTACGGCTTCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAA
GAATACCGTCGGGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGT
ACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTG
TGAGAAGTGTGGCAAGAAAGGTCCATCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAGGAA
TTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTT
GAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAAGACCCTAGATCCAGTCGATAAT
ACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGACGAGTTTTCCAGATCCAAAGTCTCTTCAACCCTGGATCTACACA
GAGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATTGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGT
CACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACTGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGA
CAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTGGGTGCCAAG
TGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGT
GTATTGGTTTGACATCTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGAT
GGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACAACCT
GGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACGGTGGGTCACTCGGGGCGAAAAATGGGTACCTACCGT
AATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTACTACTGGACCATTATGAGGAGATCGGGCGATGGTTAGCG
AAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAAT
CGCTCGGAGAAGTGGAGCTCTCGGCGGAGCCAGCTGACCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGT
TGAGATCCAAGCAATGGAGGTTGGATCCAGGACGGGGAACAATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCT
AAAGCCGAACAGCCGGATCCCGCTGATCCACGAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAATACTAGTCAAAC
CAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGTTGGTTTCCCCGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCC
AGGCGAAAAAAGGCCGCGGTGTTCGGATCCAATGATGGATCCACCGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCGGGGATCTACACGCCGAG
GACCTAGGAGAAGGCGTGGCGGTGATCCCGAAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTG
CTGAAGTGCATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAAGTCAAAATGT
GACATCGATGTCGGCTACGCGAAACCGATCGCTCAGAGGGGTGCGGAAGGGTGGCACCTCAGTTCCGAGAAAACTATCAGATCTGATTAAGGGCCTGGTG
CAAGCCAAGATCATCAGTTTCTCGACATCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTATGTGCATTGATTACC
GGTTAGTTCACGGCCTGACTCGATTGATGGTGTATCCGATGGCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGA
CATGGCCAGTGGTATCTGGGTGGTTACTATGACGTATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCCGTTCGAGTGGAACCGGATGCCG
TTTGGATTGAAGAACGCACCCCAGATCTACCAGCGCCTGATCGATAACGCCCTCTACGGATTCACTCGAATACCGGAGCCCGAAAAGGGTGGATCCGGGG
AAGACCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTAATATCGACGACATTCTAA
TCCCGGCGGAATCGTGGGAATAGCTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCGCTATCAGTGTGGTAAAGAACTATTG
GGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGAATTGGAAGCGAATCCTAAGGCCCTGTCTTCGTTAGCCGACTTGTCCTTCCCA
CAATCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCCGCGGTTTTGTATGAATTGA
GAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCTAACAAGCTCTGGCCCGGGAGATGTCGGATACACGAAGAGATCCAAGTAG
TACGACGCCAAAAGAGGACTTAAAACAGGAGCCGGATCCGCCCCGGGACCAAAAGAAAGAGGATCCAATTAGAATAGAGACGACGGACCAGAGTTCGGAA
GAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACACCCATCCTCCGTCATTTCGATCCGGAGCGTC
AACCTACGGTTATAGTTTATGCCAGTGACGGGGCAGTCTCAGCAGCCTTGGTACAAGAACATGAAGAGATCTGTCATCCAGTCACCTTCGTCAGCCGGAC
ACTGCAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCC
ATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGA
CGCTGGAGATTGTGAAGTGTTCGAAAGGGAAGG