Description :
From Genome Similarity Track
Location :
Scaffold_53:55285- 59800
Sequence
4515 bases(100 bases per row)
CGCCTTCATCCCCGcacctggtgctggctgtcCATCACGATCGACACAAACAGCTCTCGCGTGTATTTAAGGCATGGAAACGACGCGCTCGGGTGCAGTG
TGGGCGGAGAAAAGTACGAGTTTAGTGTCGGCTATCATTTGATCCAATTTATTTAACGTATGGCATCCGTATTTTTTTACATAGCGCGTCGCTACAGCTT
GTAGAGTGGGTGCTGTGTTTTACCAGCGGATTTTCTGGGAGAAATGGAGAGCTTTTGTAGCacaagaacgacaagaagggTCTGCTTTGAAGAATACGAT
CAGTGGCATTGAAAACGTCAGGGACAACAGAGAAAGGAACACACTAGATGCAAGCtacgaagatggagacgacggtgaATTTGCTGCAATTTCGGTGAGG
AAGAGGCACATCTCGAACATATAAAGCGCAGTCACTATTGTAGTTGAAATTGTTTTTATGGCTAACTGAATGCATGTTGTTTCTTGTCTAGCAAGGGCTT
ACGCTTAAGAAGCAGCCTGACATCAtcgaacacgacgctgtAATTATACGGACTCGCTTCCTGCACGCTATTCGACGCTGGAAAGGGTTTGTACGGTGGG
AAAAGGATCGTGATGCCCAGCAACAACGAGCCTACTTTTTCTTGTACTACTGGCTGCTCAAGCGGTCGTTGAGTCACCTTAGTCGATACGCactgctcaa
gaagaaagagcgTACGCTGATAGTCAAAGTCGGAAAAGCGAATAGGCGGCGTTTGATGGTGCAAGCAatgcagcagtggagattGCGGTTACGATTGCAC
CAAACGCTGCGTTTGTGGCGGAGTTACGTTCGAGGAAGACGCTATGAGGCGTTGCTTTACCGACCTATAACTGAAGCTTTGACGCGTATGACCCACCGCC
GCTTACTCCGGTTCACGTTTGATTTATGGGAGAAACAGTATAGGCGAATTCAGGGACGAAAGGCACTTGTTCATCTCCTCGACCGCCATGTGTATTGGAA
AGTTTGTGAAAGAGTGTGGAAAACATGGAAAACAGCAGTGCGCCAACTTGCCAAGCTTGAACGCTTTACTCAAGGTTATCAGGAACGTAGATTGCGACGA
ATATGGAATGTGTGGAGCACTCAAACGAGAGaaaagcaacagcaggagcagcaaaGACGTCGCGCTGTGCGTCACCACTACTTATCACTGCTACGTAAAG
GATTTGGTGGGTTTCATGCGGGGCTCGCACAGCGCCGTCTTGCGTTAGATCGCGTGGGGAATATGCAGGACGCAGCAGATCATAGAACGATGGCGTTAGT
CTTTTCGCGATGGGACCATTTCACGAGCGAACGGAAATCGCAATCTCACAAGTTGGAACGTGCAGTACGTCACTACGAATTGAAATTGCTGGAACGTGTA
TGGTCGAAGGGTTTCCGCTGTTTTAATAGAATAGCATTatcaaagaagaagatgctggcgacggcGCAGGAACACAATTATCTCCAGACAGTTAGGCGAA
GCTTTCATTTGTGGAAAGCTTTGTGGAGGGCTGAGCGTAGTCGAGATCAAAATCTGGAAAAGACGCTGGGAGAATCCTTGGTAGTGAAAGAGCAAGCTAT
TAAAGCTCGTGTGTTCGAAAACTGGTCGGAGTTTGCTCGTGCTAGAGCCGCCAAGAGGGTCGTAAACGCTCAGGTGAGGGGTCAAGCACAACAACGAACG
CTGCAGACCTCCTTTTCGCGTTGGGTTACGTTTGTTTCGGTTCTACGATGGCAGCAAATCACGCAAGCTCGGGCGAAACAGCACTACAAATCTGTACTTT
GGAGGAAATGCTTCGAACGGTGGCACTGCAACGTAGATCTACGTCAGCTTTATCGCAACAAGGTTCGAGTTGCTCTGGTACATTGGAAGTTGAATCTGGA
GCGCAAGGCATTCGACGGATGGAAGCAATACTTGAATTGTAAAAGGACCAAGCAACAACGCATCCATGAAGCCCTCGGGTTTCGTCACGAGCAGTTTGTG
CGCGATGGTTTACGGCATTGGATGACTGCtgctctgcatctgcagGAGCAGCGCGAACAGCAAGTCGCACGTATCCAGGCGAGCAACACGGCACAAGTTT
GGCGCAGGGTTGCTGCCATAGCTAGACACTGGCGATACCTCGCAGTTCGACGTCGAACTCTCGGGAAAGAAGCACAAACTGTAGGACGATCGAGAAAGGG
GCTACGGCCCTTTCAAGAAGACTGGCTTTGGCAGTTGGAACACGTagcgcctccaccttcgAATGGAAAGAAGTTCCGAGTACCCTTTTTGGATGGTGCT
GGAGTCTCTAATCGGACAGACAAGAGGTCCCCATTGTCAGAGTTTGTATTGATTCCGAGAAATCGTCCGCAGCCTCGAAGACCTGTCGAGGTTCTGTTGT
TCtcgcaagcagcaacggaaAATCTTCGGCAGCCAAACAACAATACACACATGAACGAAGCACTACGCTGCGGCTTTGATTTTCCAGCAGTACCATTCAC
TCTGTCAAGCCCACCATCGGTCGAGCCACCCAGTTCTCCGACGAAGAAACCTTCTTCTTACACCAGAATACAAACAAGAGAGCACGGCAAACGCCCAGAG
GTCACCACTACCTCCGTGTCACCTGTCCGAGAAGATGTGGACCCGCTGCTACCAAATACTACAGCTCAGCAGTTGGATATATTGGAGCGGAAGATTATAG
CCTTGAGCCATCGGAAAAAGGAGTGGAAGGTCTCTCAGCAGCAAATTGAGCTATTGCGTGAACAAGTGGAAATGAACCCCCAACTAGCGCTTAAACTTCG
AGCAATGGAGGAACAGCATACAGTTCGCACGAAGAAATGGCTTCATACAAAAGGACGTATTCGGTCTCTAGCAATGGAGATTCAGCAGTTGCGAAGTGCT
TTGCAGGGATAAAACTACAGCAAATGAAGCAAATGCGAGGCGTTTTGAATCACCGCAGTAGGGCTTCATATTCGCTTATGAGTGTTGCACATTCAGCAAA
AGCAGTCTCAAAATCGGCATCCTCCATCCCGTGTTGTTTGTACCAGTGGACGTAGGCGCTGGCATGGAATTGACGTTGGGCTCGTTCCATGAAACGTTTC
GTGCTGGCCAGAAAGTTACCATTGTTCACGCAGATCGTTGCGGAAGCTTTCCCTTGCAATGCTGGAAATGGCTCAGACCTCGAGTACGTGAGCGCGGCTT
GCGGCGTTGCTGTTAGCCATGGCACTGGGGGAAATGCAGTCTGAACAACCCCATCAATCTTTTCTGAAAAGCGGCTACTTTCGCTCGTCGTTGGAATAAA
ACCACGAACTATAGTACTTGATGCCATCACTGTGCTCGAAGTACGCGGGAAAGAACCACTTGTTTGCTGCACAAGCTTTTCAAGTATTTCGAGAGATGTA
TCAAAGTCAGCAGCTTGGTTATGTCGAAGAGATAACGAGCGCGATTCAGCTACCACCGGAGCATGGAAAAGGGCAGCAGAAAAGACCCCTTTCGCTACAG
ACGTCTTTGAAGGAAGCTTGCTGCGTGTACCTGACCTAGCTCGGCCTCGCCAAACGCCCGAACGAACGTCAAGCATCTTGACTGCTGGCATGGGGCATAC
GTcatgcagcaacttgccgAAATCGAAGGATCGAACAGTACTAACCTCCCCCACAGCTACTGGAAACAACAACCCCGCCAGATCTGCAGCCACCATACTG
TTGATTTCATCCAGCGACACGCGTTGATTCGAACAGTCAGTTCTTGCTCCCTCCTGAAGTAGGGATTTCCAGTATCCCGCCGTTCGGAGTAACTCGTCGT
TATCCTTGTAAATAACCGCATCCGCAACTTCTTGCAGACATCGCAGCGTCAAGACTGCATTATAATTCTGAAGAGGGGTATCCCCACGAGTGCAGGACGG
TGCTACTGAAGCAGTCACAATATACGACTTTGGGTATATGTCTCTCATGTTTTCCAGCACTTGACATCCCAATCCTGATCCTGTTCCTCCACCCAAAGAG
TGCATCACCACACTGCCTTGATAGCAGTCCACACTTTCAATCTCCCGACGTATTGAGTCCATGACGAGCTCCACTAGCTCTCCGCGCTCATGGACACCCA
GCGACACGAAGGCCGGCGCCGGAGCTTTCCGTCTCGGTCCGTAGTATCCCATGGCCCAATTATTGCCTCGGCCCGCCTGTTCCACGTGCTTATGAGCAGG
gtgaaaagctgcagcactatCAGTACCAGCTTCACATATAGACTGAATCACTTTGGGCTCCGAATCCACGAGGATACAGCGAGCAGCCCCACTCGACGGG
TGGAACAGGTGTGTGGAGAGTGATGCGCACTTCTTTGAGTCGTTCATAGCGGCGCTGGGGCCTCCAGACGCACGACGAGTGTGTATAGATACATTCACGT
CACCTCGGTTACGATTATCTTCTTGAATTTCGCCAGAAGCAGCCGCCAGCCGCCAGTACGCAGCACCCAACTGATTGCCACATTGCCCGATGTGTAGATG
GACGCTCATCGATTC