Description :
From Genome Similarity Track
Location :
contig_7:55262- 56814
Transcript NameFunction/comments
g1993.t1hypothetical protein
g1994.t1hypothetical protein F442_21110

Sequence
1552 bases(100 bases per row)
GGGCTTCACGTCGCAGCTCCGCGGCGCCGCTGCACATCCACCAGACCTGTCCACGCAGCTTCGGCGGCACGCCGGCTTTTAGCAGGGCGTCGAACTGACG
CGCATGCAGCATGAGCTCCGCCGCCGTCGCGAACGTGGACAGGGTCATCTTGACCGTCTTCGGCGGTGTCTTCTCCTTCTGTTGCTGCTCCACGAAGCGC
TTCTGGTTCTCCTTCCACTTCTGACACACGCGCTCCTGCGCCCAATCACGCGCCGCGAAGCGCTCGCTCCATTTGCGCAGGCGGAACTTGTACAGATCCT
CGGCTGTGTCCAGCTCGACCGGCGTCTGCTGCACGAGACACTGTAGCACTTGGCGCTCGCAGCGACAGGCCAACGCCAGACGCGCGTCGGCCGCATCCGC
ATCCGCCTCCTGTACGACCAGTGCCGCCGTGGTCAGGCGGAAGCGGCGCGTGGGGCGGAAGCACGCCAGTTGGCACCCGTGCACACGCGGCGTCGAGGCG
TCGGTGTGCGCCATCCTCGTCTCGGTTTTATGTGGGACGTTCTGATACCGGAAGAAGCCCTGCGAAAACGAATGCCAACTGCTCGTGGATTGGATGAAAA
GAGACGACGAACCGTCGCAGGAACTGTACCGGAAAACCGGTACATCCAGGAGTGATGGTTGTGTTCTTCAAAACGGGATCGCGAGCCATACCGACTTGAG
CATGTTGCGGCTATCAACGCTGGCTGCGCGCGCTTCCAAGCCGCTCTCGCGCTCCCTGCACGCCTCCTCGCCCTCCGCCTTCCTCGTGCGCTCGCTGGAC
GATGTGCGCAAGAGCCACCGCGTCGTCACCAGCGACGACGGCGCCCTCGAGACGCGGTACGTACGCCCCCTCTTTTTTCTTGCACCATAAACTATTATTT
TCTTATCTATATGACGTAATTGCATGCCCACGTTGAAGTCGCTACCTGGTGCGAAATGACGAATGCGGCTTCTCGGTGCAGCAGGAGGTGCTGAAGAAGG
GCATCCCTGTGCGTCTCGAGTTCCAGAACCACGTGTACGCGCTGCTGGTCACGCACGGTAGCGGCCGCGTGCGGCTACTTGACGTGGGCGAGGGCCAGGG
CCAGTACCAGGCCGTGCAGGAAGGCTCGCTCGTGGCGCTCAACGCCGCCGAAGCCGTGGAGATGGAGGCCGAATCGGACGAGCTGCACGCCGTGAGCGTC
ATGAACCCGCCGCTCTTTGGCGTCGAGAAGAGGAACCCGACGACGGGCGTGTTCCCAGCTGTGGACGCGGACGGAGAGGAGCTCGAGAGCTTTGGCCTGG
CCGAGGCGGAGCGCCTGTTCTCCGCCCCCGAGTCACTCCAGGGCGGCAGCGCCCCCATGAAGGACGACCCGCTGTTCTAAGGAAATAGCAGAAAAAATGA
CGTTGACTCGACACTTATGAGGACAATACAGGTGAAAATGCTGCCAGATGCAAGTACCAGGGTCCTGCTTGGTGCGATACGTTGAATTAGGCTTTGATTT
TTGCTTTGTTGTGGTGTCTTCAGAGCTGTGAAGGTTTTGAGAGAGACTGTCG