Description :
From Genome Similarity Track
Location :
Scaffold_1065:5525- 7623
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1065-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily
Pytap_DAOMBR444maker-pag1_scaffold_1065-fgenesh-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
2098 bases(100 bases per row)
GCTCGCCGCTACTATCAGTGCCAGTGCACTATCCGTCAACGCTCAGCCGTGTGGCGAAGAGACCAAGAGCCTCGACCAGCTCTACGAAGACGCCATAAAA
GAAGGCGGCAACCTCGTCGTGTACCACGGCGGCGACACACCCACACAACAAGACTTCACGGCCAATGCCTTCCGACAGGCCTTCCCCAAGATCAACCTCA
CCATGGTCGTCGACTACTCCAAGTACCACGACGTGCGAGCAGACAACCAACTCGAGACCAACACGCTCGTGGCCGACGTCATCGCGCTCCAGACGCTGCA
GGACTACCCGCGTTGGAAGAAGCAAAACAAGCTTCTCAACTACAAGCCAGCTGGCTTCTCCAAGATCTACCAGCCTTTCGTCGACCCAGAAGGCGCCTGG
ATTGCACATGGCCTCTTCTCCTTCAGCTACTTCTACGACGAAGCTCAGCTGAAACAACTCAACCTGCCAGCTCCCGAGACCGCCAAGAATCTCGCCGACC
CCATCTACGCCAACCACATCGCCTCCACCTACCCGCATGATGACGACGCCGCGCTCTTCGTGTACTCACAGTACATTGAGAAGTACGGTTGGGACTTGGT
GGCCAAGATGGCCAAGCAGAACATCCGATTCAAGCGTGGCTCCAACACGGCCGGTGAAGCTGTGGCTGACAAGCTCAAGCCGATCGGCGTAGCTGCAGTC
GCTCCCTTCGGCGTTGCCAACATCACCACGGTCAATGGAGCCGACTCGGAGACGCCATACCTCGCCTGGGGTCAGCGCATGGCCATCTTCAAGAAGGCTC
GCCACCCAGCCGCGGCGAAGCTCTTCCTCAACTGGGTCATCTCGTACACCACACAGTCCACCGTGCTCGCTGGCATGTCCACGCGCACTGACATTCCACC
AGTAGTCGGCAAGGAGCATCCATGGGAGATTCCGCAAGCTGGATCGCTCAAGTTTCAGGAGTGGATGGAGGATCGCGCCGAGATTGAGCGTCTCAAGATG
GTGATGGCACTGTACTTCGGTGAGGTGCAGGGTGAGCCAAGCCCTGGTGTGCTCGGTCGTCACCCGGGACTCGAAGGCGCTGATCAGATGGATCGATTGA
TGTGCACGTTGGAGGAGTGATCGTGGTCTCGCCCACGATATCAACCAGCGTCTCGGTGATCAATCAATGTCTTTTCAAACTAGTAGTGATAGGAAGCAGT
TGAATGCAAGATCCATTTcGCCCCGACATTATCGAGAATGAATGACGCTGTGTTtGATACGAAGTACCGGTACAGAATAACTAGATAGCCCCTCAGTAGC
TCTAGGAGCTTCCACACTCCAAGAGTAGTGTAACTACGAAGTAGTACGCGTGTGTGCCTCACAGTGAATGTAGATCCCATGGAGTGTATTCAAGCGAAAC
GACTATTACGTAGTAGACACGGATCTCACACAACGGGCGTGGGTTGGAGTTGAATGCATTGAAAAACGACCAGTATGATGTGTTTCGTTTCACGCATTGT
GCAGACTATTGATAGTACTGCTGTTGCACCCTCGAGAGATTTACTTACCAGGGTAAAGACCAAGGAAGCCCGGGCTTGGCTCGCCCTGCACCTCACCAAA
GTACAGCGCAAGCGTCATCTTAAGACGCTCGATGCTGGCGCGGTCCTCCATCCACGTCTGGAACTTGAGCGAGCCGGCCTGTGGAACATCCCAGGGGAAC
gACGTGCCAGCAGGGCGGGCAACATCAGTGCGCGACGACATCGGGCCGAACATGTTTGTCTGAACATTAGTAGACACGACCCAGTTCATAAAGAGCTTCG
CCGCGGCTGGGTGAGGGGCCTTTTGGAAGATCGCCATACGCTGACCCCACGCCAAGTACGGCGAAGACGCGTTCTTGTCAGCAACCTCTGTCGCACTGGA
GGTAGCGGAGCCAGCGAGACCAATGGCCTTCTGCTTAGCCGCGACAGCCTCAGACGGAGTGTTGGAACCGCGCTTGAACTGAAGGTTCtGCTTGGCCATC
TTGGCCACCCAGTCCCAGCCGTACTTCTCGATGTACTGCGAGTACACAAACAGCGCGGCGTCATCGTCGTGAGGATACGACGAGGCGATGTGGTTGGC