Description :
From Genome Similarity Track
Location :
Scaffold_1159:5524- 13126
Transcript NameFunction/comments
Phypl_g12603hypothetical protein

Sequence
7602 bases(100 bases per row)
CCTTCCTCCTAGCGTGCGGCCACCCCGCACACTCATCACTCACTCATTCCCCcttcgcagcagccaacCTACTGCGAAGAGTCGCCCATGTCCCCTTCAT
AGGACTACATCACGTCAAACCGGTTTCGGCTCACGCGATCCCGCTCGAACTCGCGAAGCAGAGCGCCACAGTTCAAGGCGGCCTCATCCACCCACGTCGG
CTCGTCGTACCCCTTCCAGTACACTTGGAACTCTTGATGTACTCGCCCGTACCGCGTCCTCCGCTCCAATCGTACGTCCACGATCCGCTCGACTTCAAAC
TCGTTTGCATCTAACGCTCTTTCCCAGCTGTCTTCTGGCAGGAGCGCCTCATTAAAGTCGACGCGCTCAGACTTGCCTACAGCGAGCGACACGACTGGCC
GATCTGGAAACTCCtgaccagcttcagcttggacacGTGCACCGTCGGAAAGACCCGGTACTCGGCACCTGCGATCTCCAACCGGGCAGCATACCGATCC
ACCATCTCTGCTACGCGAAACGGCCCATGCCACATGTgtgccagcttcttcgcgtagCCTTCCTTCACTCGGTCCAAGAACAGCCACACCTGTGACCCTG
CCTCAACCCCGTGCGGCTGGAACTCCGAATTGTGTTGGTCGGCCCGGTCTTGGATCGCTTCTCGAAGACGCTCGTTGACCTGCTCACGAGCTCGCTGGTA
CTGCACCTGGATGTGGTACCGCCATCGGTGCGGATCTGGATTGCGGCGACGCGTGCTGCCTAGCGGCAGGGACGCCTCCAGTGTCGACGTCGGGTCCCAA
CAATGGACCAAGTAGAACGGGGTGTCGCCACGAACTCGATCCTGAGCGGTATCCAGCGCGAACGTGAGACGCTCCGCATACTCGTCCCAGTCCTTCTGGT
TGACATCCGCCACATATATGTTGAGCGCTCGCGTCAGTGTCTGCACCATGCGTTCCGTCGTACCGTTGGCCTGTGGTCGgtacgccatcgtcgccctCTG
CCTCTGGCCCACTATACGGTTGAAAGCCCGGAAACACTCTGACATAAAACCGGGTTCACGATCATGCCGGATTGCCTCACTCGCTCCAAAGCGCCGAAAC
ACGCACTCCTCGTAGTTTTCCGCGATCGTCTGCGCAGTgcgcgaagcgctcgccTTCGCGATCACGTATCCAGTGAACAAGTCGACCCAGATCAAGAGCT
CGGTGTTCCCCTTGAACGACTTGGGTAGCGACGGGATGTGGTCCATCGCGACTATCTAAAACGGGTACGTGGCTCGCATGTTCCCCGGCGATTCCCCCCG
GATAAGTGGTCGCCCCTTCCCAGTCTCACAATCAACGCATTCTCCCAGAAACCGTTGGACACTCCGATATAGACCTCTCCAGTGGAAGTGCTTCCTGATC
GTCTGGTACGTCCTCCCAATACCCTGGTGCCCGCCTTCCAACCTAGCATGGTAGTGATGGAGAAAGTCTTGTTGCAACGTGTCAGGTACCACCAGCCGCG
CGATCGAGTCTCGATCTTCATCAACTTGCTTGCCCACCGGACagaagaacagcagctcaTTCTCATCCAGATCGTAgtcgtccgcgagcttggcgcaGGA
CTTGGCTTCAGCGGTGCTAAGATTGACTACGTCCCCCCGAAGGTACGCCTTCAGATCTGCGATCCACTTCTCCTCGTTCTGAGCTTGAACAATACGCTCA
CTTCTCATGCGTTGCACGATTGGTTCTTGCAGGACTTCGAGCTGCGGaggtcttcttcttgccgatCTAGTGAACGCAGTCACGCGGACGACTGCGTCAA
CCGTTTTTGGCTTCAGCAGCCCGTCCAGCCTGTTGAGTGTGATCAAGTCCTGACGATCTTCCTCCGAGGTAAccactgcgtcttcttgaccTTGTAACGC
GGTACTTGCTAGCCGATCGGCGCTCTGATTCCAGTCCCGCCTCATGTGCAAGAGCTCATGCTTCGGCCACGATCTAAgtttctccagcgccttctgtCGG
AGCAGTTGCAGACCGGGTGCCTTGCAGTCGATTTCTCCGCGCATCTGCCTGATCACCAAGTTGGAGTCTCCACAAATGATCAGTCGCCCCCTGTCCAGAT
CGGACAGGAGATCGAAGCACAGTAGCAACCCTCGATATTCGGCTTCGTTGACCGTCAGGTCAGCCGTATATTCCGACGCCGCGGCGAGGATCGTCCAGTC
GGGGAGTTTCCACACAATCACGCTGTAGGTTCCGGCCTTTCGCTTGACGCTCGCAGATCCATCGAAGCTGACGACTAGCAGACTATCATCCAGCTCGACT
GTCGGTGGCAGCATGGTGACTACTTGACGTGGCTGTTTCTTCGGCGCGATCGAGACGTGATGCTTGCTGCGATCATACCAAGGATTTCGTCCTCGCCCTG
CGTACACTTTCGGATCTCAAGCGTCCATTCAGAAAGCAACGCAGCCCATAGGCCAAGTCTACCGTCCAGTCCAGATGAGTTCACCAGCCCTGCCAACGTC
GAGTGACGAGTCAACACCTTGATCGACCGCGTTACGAGCAACGTGTAGCAGACGTTCAGGACTCGGCGAAGGGCTAACACCTCTTTGTTGACCATCCCGT
AGTTGATCTCGTTCGCCTTCAATGTACGACTTGTGAAAGTCACCGGCCAGTACACACCGTCGTGTTCCTGCATTAGCGCCACGGAGATCGCCCATTTACT
GGCGTATACTACCATGACTGGGGTCCGATCCGGATCGAAGTGACGAAGTATTGGTGTGGACGCGATCTTTGTCTTCAGCAAAGTGAACGCGACCGTGGCT
CTCACCCAGCGATCGTCCCCCTCAGGTGGCaacgcagcgccacctgTCTCTCGGCTTCCAGTAACAATCTCGTCTCGTCCGCGGAATTCGTGGGAGTTCA
CCTCCCGCAGCTCGTACAAGATCGCAGCGTAGATCGCGAAGCCCTCTGTGATGCGGCTGTAGTAGTTCAAGCTGCCCAAGAAAGACTGCATCGGTCGTAG
CGTACGCGGGAACGGGAGATTGACCAAGGAATCGAGATCCTTAGGATGGGCCTCCAGTCCACTCGCGGACACCTGATGCCCCAGGTAGGCGGCCTTCCGG
CGTCCCCAGACACTCTTGACCACACTGACCGAGAGGTTCCACTGCTCGCAAGCGTCCAGCAGGTGATCTACCTTTGCGCAAAGGGTGTCCCAAGACTCGG
CCGTCACcgagacgtcgtcgatgtacGATCGTCGTCCCAGGACGGACGGCTTCAGATCGATGTCAGGTTCGCCACTCTCGAAGACGTCACTCGTCTCTGT
CAAGTCTGGATCCGCGCTGATCTTCAGGTGTCCGTACAGCGCATTGTCGATGAGCCGCTGATAGATCTGAGGTGCGTTCTTCAATCCGAATGGCATACGC
AGCCACTCGAAAAGCCCGAATGGGGTGATGAACGCTGAGATCAGCCGCGCTCGCTCGGTCATGGTGACCACCCAGAATCCACTCGCCATGTCAAGAGAGC
AGTACCAAAGCATCTTGTCCGAGTCTCCCAGAAGATTGTTGATCAGCGGCATCGGATACACCATCAAGCGCGTCAGGCCGTTGATGACTCTGTAATCGAT
GCAGAGTCAAATGTCAacgccgttcttcttgatgatgATCACGATCGGGGATGCCCACGGTGAGGTCGAGTGCTTGATGATCCTAGCCGACAGCAAACCC
TTGATGAGCGCAGCCAACTTCTCTCGAAATTGTGGAGCAACCGGTCGCACGCGCTGGGCTACTGGAGTAGCACCAccgacgtcgatgtcgcacATTGCAC
CGCGTGCCGCATGTGGCAGAGCGTTCCCTATGCCGATCAGCAGgtgccgccttcgccagATGATCCGTCGCAGCCGGTCGATCTCTTCCGGGGTATTCAG
ATCGGGATCGCCAACCTGAATGTCTTCGATCATTACCCCTTCAGTCGAAGATGCTACCTCGGGCAAGATGACCAAGTTCCGTCCGAGATCCTCTGCGAAA
AAGCCTCCGCTCTCATGGTAACAGACATGTTCGGCCTTAGCTTCATCCGATCTCGACTCCAGTGAAGGGTCGACTTCCGTCTTCGGCAGATCCTGTCTTG
ACTTGGTCGACTCTGCTTTCGGGATCGGTGCAGGCTCCTGGTCGACTCGCTCTTCGTCCACCTCTTCACGCTTCACCTCGGCTTTCGGCAGACCTTCCCG
TGTTCCTTCGCAGGGCGATGGTAAGACTGTTGCTACGGCCACCACTGGTTTAGGAAGCCCATCCGACCGACTCAGAAttcgcgtcggcgtcggatATTGA
GGCCGATCCACCAGCGGTTCCACTGACTCTTCTTCGGGTCCGGGTTCCTCCTGTCGCTCGGTGGTAGCCTCGAACGCGAGGTTCTGTCACTCAGCGTATC
TGGGCGATCCGACTGAAACAAAACCTGGCATACGAGGTACGGCGTCTGGGGCTAACCAAGTTCCTAGCCGTGCGTGCCGATCGAGCACTAACTTCTCTTC
GCTCACGCTTGTGATCCGCAGATACCTCGTTCTACCCAGACCTCTGATAGCGGTCGGCACCCATCTTGGATCCCGTGTGATCCAGAGCTTCGCGTTAGCT
GATCTGCCGAATCGGATCGGGAACTCCACGGACTCGGCGACTGGCACTTCGAGATCTTGGTCAAGCGTGACATGCTGGACCGCAGCGCCGTACAGCGGAC
GCCGTCCTAGCAGCTGAATCAGCACCTCGTCAAGGAGACAGAACGTCCCATCTGCCAGATCGAGGCGCACTCCGGCTGGTACCATGAAGTCCATGCCAAG
TATCGCTTCCTGTCCCGACTGATCGCTAACCCAAGTGTCGAAGTAGTACACCAACGATCCAGCCAGTGTGACCTTGATCGTAGTACGTCCAACCGTCATG
TACGTGTTCTCTCCGATCCCAACGCATTCTTGTCTCTGACTTTCGTCTGTGACACACCCAGCCTTACGAGCAAAGGTGGTGTCTATAATTGAGACTTCAG
CGCCGGTGTTGAAGAGCAACGTGGCCTTCTCATTGTTCACCTTGGTGACGGCTTTGGCTTACTTGAACCACTTCCCAGGGGCATGACACTTTCAGTACCC
TCGTGATTCACCGGACTGCAGATCGGGAAGCGTCCCACCCCCAGATCGCCAAACCGTCTTGACCTGCCGGATGCTTGGACTCCCCGACGTGTCTTCCTTC
GTGGCAGGGGCGAACCACTGCTCCGGATCCCGTTGCTTCCAGTAACCTCGCTGTTCCCCGAGTTGGAGATCCAAGGCTACCTTGACATCGGACCTGGAGA
ACTCATCATCCAGCCGCAGGCTTGAGATCGCCACAGTACGTTTCTCATGCAGGTCACATGTATTACCGTGTAGATCTGGCCGCTTGCTAACTTGATTTAC
CGATGTCCTGTCCTTGAATGCAAATATGCAATATCTAGAACGCTCGGCTCGTATCGGATTCAAACCCGACGAGTGTCCTAGTTTAACATCTTCTCCGCGT
TGGCTGGCAATATCCCGGCATGCTTGCTGGGGTTGAACCACTGGCGGATCAAGTTGTAGAACTCCTCCATCGGGCACTTGCCGGCATCATGCAGTTCGCC
ACAGGCACGGCACATGAAGAGGCAATGATCCGACGGATGACCCTTTCTGCCGCACTTCTCACAAAtcagcctcctccagcagttCAAGTCGTCATGCTTC
CTGGATCCACAGAGGGAACATTGCTTCGACGGGAAGTTCGGGTCCGATCGATCCTGCGGTCCCGCCGCGCCTGGGCGTGGTGGCTGCCAGTTGCCTTGAT
CCTGACGATCGGCCTTCGCGGCGAGGTAGATCGGGCGCAGATCGCCTTCTGGTTCCGATCCGCTGACTTCCGACTCCGACTCGCTGAGTTCTTCCGTTGA
GCGTATCGTCCGAACCGCACGAGCCGATTTCGAGGGAGCCGGATGAGGTGGCGACGCAGCCTTCTGGCGGAACTTGCTCGATCCGACTGCTGCCTTTTCT
TGGCGGGTCTTGGCGCGCTGGCGCGCACGCAGCGTACTTTCGAGATGGCCCGCCTCGGCGATCATCAGTAGCGCCAGTTGGTCCGCCAGTTCACGATCGT
CCAACGTCTCGATGAAGTGTTCGACGTGTTCCCGGCGAGCGTCCGGCGATCCATCCTTGATCGGGAGCTTCGCTCGCATTCCAGCAACGTTCAGTCGGTG
GAGATACTCGAGCGGTGATTCCTCGGATCGCTTCCTCGCGTGGTAGTACTGTCTCGCGACAGACACTCCACGTCCGCAGTATTGGGTCAGGAAATCCTCG
AGCAgactcttccagctgcttcgCGTCGTCCGACTCAGCTGCCGGTACCAGTTACGGGCTGGTCCCGTGAGCAGATCGCCGAAGATCAAGCATTTCTCGC
TGTCTGGAGCCTGATCGCGGATGAACGCCGACTTGACCTTGCCGAGCCAACTTCTGGCGCGATCTTCGTCGTTGCCTTTCCCCTAGAACGCCTTCAGTTC
CGAGATCGCGGACACTCGGATTCGTgcggccgacgtggcgtccCCAGTCGTTGCTACTGCGGTCGCCACCACAGCACGTCGAGGCTCGCCGATACTCAAG
TCATCCGGATCGTATTCGTCCGCCGGAGGTGGATCATGATCCGATCCGACCGACATCATCTCAACGTCTGGCGCATCGTTCGGTCTTGGCTTCTCGGGCG
ACTTTGGCGTCTcacgcggcggtggcatcCGATCCTGCAGCTCACGTGGTGGTTGCATCTCGGCCCCTTGCTGCTCCTTCAAGAATCGGGACATCGCAGC
GTTGAAGAACGTCTGCATGCGGTCTGGCGAGTCCTGTCCCGGGGCCGGCTTCGCCTCCTTCTTTCGAGTATCCAGCAGGGCGGTGCCAGCTGGTCCTAGC
GTCATCCGCTTCACCTCGATCGAGCTGTCTGATCCAGCATCCGACGTGACCGACGCGTACTGCGAGGATCCGCTACGCGGTTCTAGCAGCGTCGCAGCCG
GCGTGACTACTCCGACCAGAGCAGCTAGCTTCTCGAACTAAGTTAGCGTCGACTTCGCGATCGCGGCCAGTTCCAGATCGAACAACTCCTTCGCGTTGAA
CGCTCCCGGCACGATCCCAGCTTCCTTCAGCATGCGCATCAGGAGCttcaccgcgtccagcttgttgGACACTTCCGTGGGCGCAGTTACGGGTCCTCGA
AGATCACCGATCAGCTTCAGCCGCATGATCTTCAGAACTGGATCCTCGGCTAGCAACGCGTACAGTCCCTTTCGGTAGAAGACTGCTTCAAGCTGATCGT
CCGTCCAGTCCTCAAGCGTGCTGCGATCTTCAGTGTCGGACTCCGGGgccttcagcttcatgggcggggtcttcttcttcgaggTCGCGCGCGAGGCTGG
AGGAGTGGTGGCAGATGAAGATCCCTCGGTTTTCACCGATGGATCGACATCGTGCGGATCGATACTGTGGTCGCGACCAGCGGGGTCCCCGAAGGGACCT
GgggaggagatggaggcttctcctcgaggtCCATCGCTGGACCTTCCTCTTTTacgtcgtcggagctcctCCCAGGACTCTGACGATCGGCATAACctga
tg