Description :
From Genome Similarity Track
Location :
scaffold_29:55237- 56521
Sequence
1284 bases(100 bases per row)
ATAATCCAGACGACGAGAAAATGCGTCAGCCAGCACGTTCGGGTTTTTCGGTTTATACGGCACCgtgaagttgtattctgcgaagaatgtcaaCCAGCAA
ACCATTCGCTGTGACAAGTGAGGAGACTGAACTGCGTTTTGCAAGCTTGCGTGATTCGTGTAGACGGCAAACGGAGTTGGTCCCAAGAGGTGTACACGAA
ACTTCACcagagcatacttcattgccaaaAGCTTCTTGTCTTGGACCGGATAGTTCGTGTCTGCTGGCTTTCGCTGGTGCGATTGAAAAgacacgacacg
atcgtgtccaTCTGAgaccttttgcaatagtgCACAACCGCTTGCAAACTCAGAAGCGCCATTCGCCAGGCTACACGGCTTGGTAAATCAAGTAATGGTG
CTATCATCAAACTTTTCTTGATCTGAAAGaatgcttcttcacaagtggATGATCACTTCCACGGTACGTCCTCATTTTGCAAGTTCGATAGTAGGCGTAC
CATTTCCGCGTAGTTACGCGAGACGCGATGCAAGAAATTAGACAAATCAACCCAGTTCCTCAAATCCTTTTAACTCCGGGGCATTGGATACTCCACAAAT
GCTTTGATTTTCTCAGTGTCCGCACAAACACCGTATTCACCAACATAAAAACCAAAGACCAGTACTTCGTTAGCACCGAAAacacacttcacaagatacg
cTTGCAATGAATGTTCACGCATATATTTCAACACCGCACGGGTGTGCTCCAAGTGCCTTTCTTCGACAGATCTGCCATCTTCGTTCGTTGGAATGAATGA
GAATTGGTGTACGAGAGGCGTCGCAGTGGTCAAAACAGATTAAAGACCAATCAAATCAATGTTGCTAGGGCATTCGATAGTCCTTGTGGTATCCCAAGCC
AGTCTCATAACATACCGAACGGTGTACTAACTGCCGTTAAGTGGACGTCCTCCTCCCTCATCAAGATcgggtaatatccatcagcAATCAAGAAGACCGA
ATTGTGTACACCCGGATGTCCGCTAGATGAGTGACATCTTTACGCGGAATTGGCATTCGAGCGGGAATCGTCTGCGCATTGCGTGAACAATACGTTATTT
ACCATTTGGTTTGCGCACGCAGAATGTCGACGCGCTGTGAGGGGACTCGCTCTCCCTCACCAAACCAGCAGCGGCTTTTGAGCAAAACAATTATCGATAT
ACACACTTTGCTCATGTGATTgtggccactgtcgaagCCCTACATGCTTTAAGCCAGGTTCACGATCAAGATCGTGTTGAACGC