Description :
From Genome Similarity Track
Location :
Scaffold_4:552362- 562981
Transcript NameFunction/comments
Physo_155446GlimmerM protein 276
Physo_128267hypothetical protein
Physo_128268hypothetical protein
Physo_110925translation initiation factor eIF1

Sequence
10619 bases(100 bases per row)
CCTACAGGAACGGCATCCAGCCGATGTACATCTGCGCGAGGTTTTCCAGCGACGTGGCCTCGTGGATGAGCTTGTCGACTTGGCCCTGCACTGAGAGCGG
CAACGAGTCGGTCTCCGGCAGAATGCTGCGGTGGTTCGCCGACACAAGCGGACGGATGGCGTCTCCCAAGTTGTAGATGCCGCGCAGTCGGTCGTCGATG
GTGTTGAGCACGAGGCGCGTCTCCTGTTTGGTGCGCTCGGTTGACAGGTCAGGGATGGATTTACCGGCACTGTTCTGCGTGGCCTTGCCGCGACGACCCC
ACTCCACTAACGGGTCGTGGATAAAGGCCTCAAGTACGCTCCGTAGCGTCTCCTTGTTCTCTCGAAGCAGACGGATCGTCACCTCACTGACGCGACGGAA
AACACCCTCGTAGCCCGTGATTCCGAAGGCGTCAATGATGTTTGGCGTCAAGCGGAACGGCACGATCTCGGGTTTTGCTAGCTTGAGACCCTTGTCGAAA
AGACAGTCGAAGTCCACATGCACGCACTCGCCATTAGTGCAGTCGATCAGAATGTTCTCACCGTGACGATCGCCGAGGCCAATGATGTGTCCAACCATGG
ACCATACGGCTGCCGACCGCGAGAAGGTGAGTCGGGCCTCGAACCATGCCGTAGGATCGGCAAAGTTGTTGTAAAACCACTGGTGGAATCTTGGCGTGAA
AACAGGCATCGAAAGCACCTTACGGCGGTAGTATCGCGCCATCGCGTGAGGGTCGTTCGCGTACTTCTTCTGCATGTTCAAATATCGATCCTTGACCTCA
TGCGTCATTCGAATAGGCTGAATGTACCCACGCTCCGTTTTGTGGATCTGCCCGATGAGCTGCCGCATGGCCTTCGTGTTCCTTACCCACTCCATCAGCC
CGCTCTCTTCGTTCAGCACCACCACCGCGTACGTGCGCAAACGGAGTTTCCGCTTGCGGCCTTCTTGATCCTTCTGCAAGAGCTTGTTAATCATCGAGTT
AAACTCCATCATGCGTGCATCCTTGCGTAAATCACCCGTCTTCTCACGCTTGCACAGGAACGGATATAAATTCCCATCGGTGCCCAAAATTTCAATGCGC
TTGGGTTTCTCCTTGGTCATCATCACATCAGCCTTGTCACTGAAAGCCTTGATGTAAATTTCAGCATTCGCTGAGAAGGCAACGTGAAATTCGTCACGAG
GGGCTTTCCCAGACACCGGCAGAATCGTAGTCAGAGCAGCCTGAATCGGCACGAGAATTCTAGTCCGAATCCGACTCAGTCGAATGTGAATCTTCCGTTG
ACTGTTGCCAGGGTCGTGGCCGGCGAGGCTGATCAGCTCGTCTGCCATCCTCGTTCCCTCGGAGAAGCTCTCTGCAATCTCTTTGAGGCCCTGAGAGATA
AGCTCCTTCTGTGTAACGGAGATGATCTCACGCGCACGATTGCGTCGCTGCGTATTCAACGATCGCGAGAGGCCCAGCAGCGGCCACATAGCTTGAGTTG
GATAAGCATGTAGCACCCGAATCATAATTTTCTTGACACCTTCAACCACAACAGGATTGGGATGACATATACGCGATGTCACTTGCGGAAAGCACATGAG
CCATTCGTATGCTGGCAATGATTCGGCCGCCTCGTTGACAATGTTATCGATATCATCGAGGATTTTTTGTTCTGTGGTGGACTGGCTCAACCCGATCTCA
ATTTGCCGCAGAGCCTTGTTTGCTTTGTTGCTGGTACGTCCGCCGGTAGCACTCGCATATAACACTTCTCCATACTCGAACCATAGCGTAAGCAGTCGTG
GAAGGGACTGAAAAACAAACTTTGTTCCATGCGATAATGCGTGCACGTAATTCTTCATCAAGTTGATCAGGTGCGCGTGAAATACCGAGTCTATCACAAC
TTCGGTCGAATCATTACTCATCGATCCATTGAGGGCATCCGGATGGCTTATGCTCAGCAAGTACTCATAGTACTTTGCTAGGAAAAAATATCCTTTCTCC
CACGTTGGATCAAAGTGAATGACAGCTTGATAGCGCTCGATCACCTTTTTGCCCTGACGCTGGCCAGACGCCTGCATCCAGTTGGTCGCCAAAAGCAGGT
TTTTAGCGCAGTAGTGAGGGTCTTCGACGTCATAATCCAACGTATTAGCATCGATGTCCATCGGCTCCAAGATCTGCAAAGCCTCACGCATTCGGTCTTG
GCTGACCAGTAGCTTGGCCTTCTCTATCATCGCGTATTGGTTATCCAGTGCTTCAGCGTGCATTACAGCACTCGTAGCTGTACGGATGAACCCTTCTTTT
CTGGCTAGTTTCGCGTACAGCAACCAGTTCTCAGATACTTCGCTGCGAAGCCCGGCCTCGTGAAGAAGCACCCGACGCAATGCTAGTATGGGATCACGGT
ACTTGAGGGATGTTGCAACTGCATCGTAGCGCATTTTCCAAGGGGTCTGCTTTTTCCACAGAAGACTGCGTCGATCCAGGTCTTCGCATTCTTTTGTTTT
CTGTAAAAATATGAACCCCTGCTCTGCCTCGTGCAGAAAGTGGAGATCGTGCAGGAGCGGGTATGCACGCTGGTAGGATTCAGCAGATGCCGCTGCAAGA
GGTCCCATTACTTCCAAGCGCGCTGCTTTCAGGTGACGCTGAAACTCTTCTTGCTCTCCACCATGTAAACTGTGCAGCACGCGAACCAGCATTAACTGCG
AGACATCAAATCCCTTTAGCCGAGTGCTTGCCGGTCCTTCAGACGAGCCGTTTGACGAGTGAAGAAGGGGGTTCTGCTTTTCGGCACTTAGCAAGTCGGA
CAGAAGCTCCCACCGCGATAGTCGCCAAGAGCACTCGAGTGCGAAAGGATACATCGTAGCCATAAATTGCGGTTCTTGTGTCACAATGCCGTTTATATGC
TGCAAAGCACTCTCGAGACGGCCAAGTTGGATCAAGCAGCTAATCATTCCAGAATACAACTCGGGTTTGATCACGTCAGGGTCCTTGTGAGCGTCCGCTT
CCAAAATTTCGGCCGGAGGTTGCATCATTTGAAGTTGGCTGTAGTGTGGTCGGCTTGATGGCAATGATCTGGAAGATAGAGCCGACTGGATTTCTTGGAT
TGCTTGCTCGTAACAAGCCAAAGCGTCTTCCCATTGAGCAAGCTGCTCATGGTCAACAATTTGATGCATTAAATCGGAGAGGTCTAAGCCCTCCTCCTGA
GCCTCATCTGGGAGGTCTGCTCCAGCGTCGTTGTGCCGATAGGTGTCATACAAACGTCGCACCGCTGCTAAGCCTATAAGCGCGTCAGGTTCGTCCACGC
TTTTGTAAAGTTGCTGGAGATAAAATGCGTTTTTGAAGATCAGCGACGGATGAATCGGCCCCGCCATGGGAATATTAGCATCTCTTGCTTCAGTCGGAGT
AAATTCTTGTTGCCGCAGATACACTTCAAAGTATTGAATTGCCCGGGCATACGCTCTGATTTGATATGCGGCGTTCGAGAGTGAGCGACTGGGGATTTCT
TTCAGAAACTCTTCTAAATAATCCTTTTCGTGGTCATCAATCTCAGATGGAGCTTCGCTGCGTGCCGATGCAGACGTCTGGCGGCTGGCAGCACTAGCAG
CACTGAGCTGGAGGCGCTTTTTCTCGCTGGTCCAAATCCATTCATTCAACTCATCGATCGTAGAGAAAATGGTCTGGGAGCATTGGTCATGGCGGCGGAA
GAAATCGCCAACATTTTTCTCTGGCGAACTACTGGTGCTCTTGACGGAGTCATTAGTGTGCTCAGAATCGGGCGGTGCCATTAATACATCGTCCATCAAA
ACACCACAGTCCTGGCCGTCTAGCACTGCCATAACTTCTTTCTTGAGTTCCTCTCCAACTTCCGATCTTCCAGAGCGAAGCACATTCTGTATCAAATATG
GTAGCAAAAACCGAGCGATTTGAGGACACGTCGCTAGCGCAGTTCTGCACGCCCAGAAAACTTTTCGCTCCGGAGGCTGGGAAAGACTGATTAATCGCCG
GCACCACATCAAAAGCCATTCTTCGTATGACGTTCCGTACTTTTCATAATATAAAATGTCATCGCGTGCGATTTGAAGGGTTCGATCCGCGCTCGCAGAT
GACCGTCGGTCCGACCCGCTGCTACCATTGCGACGTGAAGAGCGGCCACCTGACACAGTGTAGTTTGTTGACCAGTATGGCTCCACAAACTGAAGGACCT
CTTTCCGCTCGAATCTTCTTTTCATCCATTCAGGCATAGGAGCATTGGGATCCTGCCTTGCTTTGTACGCAGTTGTCGAAGCCATACTTTGGCCGCTCTG
TTGTGGATCAGCTGTCAGCTCTGCCAGGATTCTTAACAGCTCCTGAATAGCAAATGCTAACGAGTCTGTGTTTTCGGGTGCTGCACGCAATTCCTTCACC
AGCCACGTTTCAATCAGCGCACAGGCTAAATCCTTCATCGTATACTCCACTTTTTGCTTTTCCTTTGCAACTGCAGCACTTGCTTGGGACCCGCCGGACG
TGTAAAACATATATAATGGCATGCGCGCACTATCAATTGCGCCCAGTGCCCCCAAGCATCTAGCACAGAGCAATTTAATCGGTTCGTGGCTCTCTGTGCG
GGAAAGCTGCAGAATAGACTGGACCACACTCGCAAGTGCCTGATCAATAAATATGTCTCCTTCATTCTGCATGAGTGCCTCCAACTCAGCACCACGTACC
GAGAGGCAACGCAGCAATTGCACCAGCGCCATTTCACGAACCGCTACATCCAGATGATTTACGTATGATGCCAGGTCCATCAAGTATTCGCGCAAAGGTC
GATGCCTTGGATCGCCATCTTCCTCGTAAAGAACGGCAAATATCTCGTCAAGCTCCGGAATTGAAGGCAGCAACGGTATTTTCGGAAACGCTGCTTTTAG
CTCTGCTCTTCTCTCGATAAATAAATACCGCAGTATACTCACCGCCCCTGTCATGCATCGAGCTTGAACCTCATCGCGTTCGCATGAACACTCGGCATCA
TATTTCAAAAGTTCGAGAGACTCCACATTCCAGCATTGACTGCCCGTTATCGCCCTGTCTTCGGTCAATATTGCAGAAGCTTCATGACCAAGACATGGAA
GAAAGCTCACAATGATAGAGCTCAAATTCACCTCGAGGGCTTTAGTTGAGAGCATTCGCAGAAAATTACCCCAAGCTTGTATCGCGTGTTCTTGCAGTTC
ACGTTCCGTGAGGGCGACCTTCAATGTTGCCATCACTTTTGGCACAAAAATATCGACGACTCCGTTGCTCTGGGTGCTAGTACCCAAGTCCGATGATGAG
TTACTGTAGAGTTCCAGCAATCTGTCGATACTCTTGATCGCCCGAATTTTAATGGAAAGTGGATTTTTACCGCTTATTCGATTGCCCAGGTCTGTCATGA
GCGCCAGGAAATACTGGCGAGGCATACACCCCTCTCCAGGTTGCAGGCTTGCCACTTGTTCGATCGTTTCCGCCTCCCTTGAATCTTCACTCAAGCAATT
TGCAACCTCTCGTATTGCCCTCTTCGCCATGCGCGACTGAGGACCGCCAAGCTCCCACGCTAATAAGTTCATTAGCCGAAGCGGAGAGTGCGTAACTACA
TCACGCACAGTGGAGTTCTCTGGTAGGAATTTAAGCAAAAACTCCCATTCTGCTAAGCGATTTTTGTTGGAGACTGCTTGCACCTGGTGAATAAGCAGGT
CTTTCAACACGTAGTCAAGGTGATTCAAGAGAAGATTCGTGATAGTCATAGGTGGATCGCCTTCTGCACCGTCCTCCATCATGATCGCATCTCCGTCGCC
GCCGTTATACTCGTCAACGTACGCATGTAACATCCGCTCGTTTTGATTCACAACATATTTCGGAAGAACGTATGGTGCGCTTGCTCGCAAGAAAACTTTG
ATGTCGACTTTCCCGCCCATGAATGTACGAAGGAACATCTGAAGCGTCTGAGTTTCCAACAGTTCGTCCACTAGAGAAAAGTAAAGCAACTCTGGAAAGT
CAACACACAAACGTCTCCATGACACACAATGATGGGAGGTAATGCGGCAAATTTGGTCAAAGGCCATGGCTTCGTATCGTGAGCGTTTTGCAATGTGAAA
ACGGTTCCACATAGAGACCAGTCGCAAGAGGATCCAGATGCAATTATCTCCACGATCACCTTGCTGTGGGTCACATTCACAGCCAACAGTACCCGACGTC
AACAGCATCGCCGTGATCAGACTCTCATCAGAGCATTCTTCGGCTGCTGTCATAAGGGCCTCCAACCGCTCCATTAATCCGGGGACTCCAGCCTTAGCCG
GATCAATCATTGCATCGAGAAGGCGTGGATGGTGGACTATTGATTCTAACACCGCTTGGCGAACGAGCCCAGAGCGATGCTCAAAACAGGCCAAAAGATA
TTCCACAAATCGCATGGCAGTGTGATCATTTCCGTAGTCGACTTCACAATGCTCAAAAACGCTTGACAATGCGTTTATCGTGATGACTTGCATATCTTCG
GAATTACTGCCAGCGTCATCGCAAATGATTGTTTCGAATAGAGCAAGTGGAATTGGTACCGCTTGGAAGCTGTTAGCAAGATCTCGACACTGACATCTGC
TGGAGCGACAATGGGCAGCAGCTTCTTTTTTATCGACGGAGTTACTAATCCCGTCAGCTAGAGCTTGGCCGTACGCTGTTGCACAGAGCATTGCTCCACA
CACTTGGATAATTGCTGACGATATCGCCTTGGACCTCGTACGCTGCAGTTTTCCACTTAATGCCTCCATGACACACGTAGCCATCCTTTTCGGAGACGTT
ATAGATCCAGCCACGATAAAGAAGGCAAGAAGAGGGATCATCGCAAGATAGGAACAAACTGCTGCGTCGGCTGTGGTCTCGCGTAGAATGCTCTGGTAAG
CGACTCTCCACGGCAGAGCATTACGCCAGGAATCCTCACCACCCAAATTGAGTATCACAGAGCGTGACCACACGAAGTAGACGAGGAAAGGTCCGCGCAA
GGGCACCGATTTGCGGAAAACAACATCGAGCACAGCCTCTGAGGACCGGAGATAGTCGTACGAGACTTCGGTCAAGTTCTCGGAAGGAGACATATCGTGG
CATTTCGGATGAACCTGGTATAGCTGTAAGAATTCCAAATACTCCCAGCAGTCGGGCACCAGAAATGACTTGTCTCGTTCGATACTCTGGGCGAAGATTT
GCTGAGTCTCGACACTCTCAACGACCTTAGCAAGCAGGTCCCGATATTTTTCAAGCTCGTGGTCATCATAATAACGAAGCAAAACGATCCATAAATCCAG
ATAATCACTCGTGAGGGGCGTGAGCGAGGGCGCGTAGGTATTCACAACCAGATCCACACGCTGAAGAAGGGCTCTGAATACGGCAAAGCTTTCCAGACGC
ACAAATGCCACAATATAGCGACGGAGTGGCAAAATTACCCGCAAGCCTGTGGTAATTGCCACTACACTTTTTCGATCGCCCCCGCTACCGATCGAAATCA
AATCAATAATCCATTGGCCCAACTTCTCGTGCAGCTCGACGCTGCTTTCGCGACGCAACACTCCAGGCGAACTCTGTTTACTCAGAAACATTTCATTCCG
CTTGCGCTTCCTTGTTGTATTTGGGTATTCACTGGACTTCGTTCGATCAGCTCCATTGTTCACTAGTGCCTTTGATATGAAGCGGATAACTTTCATCAGT
ATTTCCTTGGACGACAATACGCGGTGAATACCATCAACGACGCTCGAAATGACCGTAGGGTTTGATACTCGCACGTCGACATTCCCCAACAGATCCACGA
ACAACGAAGCAGGGGTCGCGGTGCTGGACTGGCGAGTGTACTGGCTCAGAATCGAAAGCACAGCCATCCAAATCATTTCCACCGTGCTTTTGCTTTCACG
GTTGGCTCCACAGGTAAGCTGCATATTCTCCGATACCCATGACTCAAAAGGTGGCCATAGTACATCGGTGGCAAACTTAGACAATCGCGGATATGCTGAG
CCAACCAGTTCAAGAATGGCGGCACATGCTTTTAGTATTCGAGGGTTGCTTTCATGGACACCGGTTGACGTCAAGTACATCAGGGTCAAGCGCACAAAAC
GTCGCTCCATAGCCATGCTCACCTGGAGCATCGTGTGCAGTAGGCGAAGCGTGCTTCGAGTAACTTCATCCGCACCTTGAGTCGACACAGCGCCGAACGC
TTCATCTGCACTCTTCACAAGTGCTTCATTCTTTACAATAAAAAGCTGCAGCAACTGGCACAGCCTGTCGAACGATTGATCTCCTTCCAGCATCGCATTA
TGTTCTCGGACGATCCGATCCGCCAGCACCGTCACCGATTCCCGAAGAGCCACCACCATTCCATAGGAAGTCACGTGAATCGACGGCAGCATCTGCTTCA
GCTGCTCTCTGCGCTCGTAGAGCTGGTTCACATCAGTAATGGGCATGCAGCCACACAGCGTAACATTGCTCTTGGCGCCCAGCGGTCCGTCCGCGTCTTG
GTACACGTGAATGGCCGTGTCCAAATAGCACGCAATGCTCGCCCCGCCTGGCAGCACGTCCGTGTCGTTCCTGTTCTTCAGCGACTCCTCCAGCAAGAAG
CAGTCCTCTAGCAGCTGCACTGTGTCCCGGAAGAAGTGGATGAACCCATACACGTCGTTCCGCTGTAGGAACAGCACCATCTGCAGCGTCACGTTGCGCA
CATCTCGTTGTGCTTGCTTCAGCCTCTCATTCGTGTAGAAGGACACCATGTAGAACAGCATCGTGGCCATCGTCGGGTAGGACGGGAAGCCCGAGGCCGC
CGGGTTGCCCTGCGCGCGGGTCGCACCTGCACTGCTGCTCTCCATGAAGAGCGTCATGGAGTGCGGACACGCGCCGCCTCCGAGCAGCAACGTCAGCAGC
TGGCACAGGTCCTGCAGCACGGGCACGGCCTTGTCGGTCGGCAGCGTGGCCACAGGCCGCATGAGCTTAGGCAGCAGCCTGCGCAGCTTCGTCAGCATGG
TCTTGCAGCGGCGGATGGCCGCCGGAGCGCTCGAGTCGTAGGCGCGGTCGTCGTGCTGCCGCTGGTGGGCGCGCACGAGGCGCAGCAGGCTGTCCACGTC
GCTCTTCTCCGCCTCGTCGGGCGCTGCCGCGCGGGTCGCCATGAGTGCGGAAGTTGCTGGACGAGTGCGGACTTCAACGTACTTAATAGAGATGGTGTGG
CGCACATAAGTTGCAGGTAAGTTCCCCCTTAAGTGCGGTCCCCCAAGCCAAGGGATTGGCCGCGCCACTCGGACCGCACGCTCAATAAGACGATAGACAT
GGCGACCAAGGGTGTGTGGCAGCTCAAGCAGGTGACGATCCGCTACTGCCAGCACGGCGGCAGCAGTCGCTACGTGCGCCAGCTGCTCAGCGACGAGCGC
TTCGTCAAGTTCGTGGAGGAGAACCCGCAGGTGCAGTTCGAGACGGAGCTCAAGGGCGCGCGCCACCCCGTGCTCATTGGCGACTACGGTGCGTACTACT
GCATAGGAGTTATTACATGCAGTTGGGAGGTCAAAAGGGTACTAATTGGTTGGGTTGGAATGGTGCATTGCAGTCACAAATGAGCGCAAGGTGTCGGACA
TCAAGAACCAGGACATTCCCTTCATCCTGAAGCAGGTGCGCATCGGATCCTTTCGTTCATCACGGAACTTTAGCAAATTGGCGTTTGCCTTTGTTTGGTT
CTTGTTGCTAACTTGGTGCTGGCAATTGTACTGTTCTGCAATTAATTGTGCAGCTGGAGCGCCTTCGCAACTCGAGCGGCCGCAAAATGACGCGCATCAA
GAAGCCGGTCTTCTCCAAGCGCCCGACCATCCAGGGCATCTGGCAGCCAGACCTCGACTTCCCGGAGTTCAAGATCAGCGACCGCACGTAGATGTCGATG
CTGCTGGACGAGAGGCGTAACGTTTCAGGTGTCAAGCCGAAAGGAAGCTTCGGCGACAAGTGAAACTTGCAATAGCAGTCACTACACAGAACAAGTGAAG
CATCAAATATATTCTTTCAACAGCCGCCGAGAGACGGGAAGAGAGGTCCACCACCTCGTCTCCCTCCTCTTCTTATCTAACTCTTTTGAAGCACTAACAC
CGGCGACGTTACTCGCACCGGCAGCGGCTGCGGCAGCACACAGCTACAGCTACAACGCCCTTGAGGCCAGGCTTAGAAACCGTGCAGCACCACCTGAGAG
TCCGAGCAGATCTCCTGGTCCAGCAGGAACTCGCGGATGTTGGTTCGCTGGTCGCCCGACAGCTGAATAATCTCGCCCAGCTCGTCGTCCTTGACGATGG
CGCCGTTGCAGCTGAAGTTCTTCTTGAAGGCCTTGAGGATGCGCTTCACGTCCAGGTCGTCGGCCAGGCCCTGCACCGTTGTCAGACACTTGCGGCCGTT
GCGCTGCTGCACACGCACGTGCACCTTGCCGCCGCCGATGCTCGAGTCGTCCTTGGCGTCGGCGAACGCGTCTACAGAGCCAAAACCCAGCGCAAAAAAG
TTGCAAACATATCAGCACATTGTTCCGCATCTACTGGACCACATCCTGTCTTCGCTATCTCTCTGCAGCGGCCGCAATAACGCACCGAAGGTCTGGAAGT
TCTGGATGTCGGCCATGTT