Description :
From Genome Similarity Track
Location :
Scaffold_146:5523- 12439
Transcript NameFunction/comments
Phyta_totarag4519protein kinase, putative
Phyta_totarag4520hypothetical protein PHYSODRAFT_489856
Phyta_totarag4521hypothetical protein
Phyta_totarag4522hypothetical protein PHYSODRAFT_496573
Phyta_totarag4523hypothetical protein PHYSODRAFT_313263
Phyta_totarag4524hypothetical protein

Sequence
6916 bases(100 bases per row)
tccaccCTGGCCATCTCTCTGTTGTTCGTTCTTGGCCTTAACTCCATCAACAGTTTGACTTGAGTCTTGCAACTTTCTGGTCGTTCGTGCTCTCCTCTTG
ACCAATTTAAgttgctcctcctcgtctaCCACCTGCGTCTCAATCCTCCGAAAAGTGCGTCCAGTCGAGCTCAAAGCACTGGGCAGCGCCATCCACAcgc
cgccgtcttcgtctgtaTCGTATGCGTCACTGTCACTTTCGCTCGCATCGAAGTGGTCGCTCTCCGAGTCGGAAAACACGCCAGTCTCCGCTCGTCGGTG
CAGTTCCCTCGGTCCGTGTTGCCCGTCGCCTCCAGGACGCACTCGCTTCTCTTGAGTCTGCTCGTTCGCCACGCAATTGGAGCTGGCCGACGACTCACGC
GACTGCTGGACGCCCATGCCGGAGACTTGTACCCTACCATGCGCAGCTCACACCCACGCGAAGCTTGTCTCAAGTGGCAGCTGGCCGGTTTCGACTCGGT
CGCCATTGGCCAAAAGTCCATCACGCAATATCATTTGGAATAATGGGAAACCAGCTCAACTGCTTGGCGCAATGTCAGGCGCGACAGGAGGGAGCACAGa
ggctgctggtgcttcaGAAAGGTGTTGTATAGTTGCTAGACGAATGCGGTGCATGGTGGTGTAAGTGTTGCTCACTAAACCGTGGTATTCTGTACTCAGG
TGCCTACTTCATGCGGAAGAAAACGGTTCTGGGGCTGAATACGGGAGCGGAGCGAGTCCACGTAAAGCTAGACGAAGACGGACACACGTGCGTTTCCATA
TTAATTAAATTGCTGCAATTAGTGGATGTGGCTTAGCTGCAAACTAATTGGTATCGTGTTGTGAATTGAACTTGATGGACTGTCAGACTGTTgtggaagc
tgcacgacTCTATCAAGAACACGAcgaagatcgagctgcacACGGTTAATTTGATCCAGGCACACGGTAAGTGGTGGTAGTATTTTGTTTTGGTTAAGTT
GGTTGTACTGTATGATATTGTTGGGGCATTTACAGCGTTGTTGTGTGTTCGTACGTAGGCAAGGTTGGATTCACCATTACGTCTCAAAAAGGCGATGTGT
TACTGGATGTGGAGGCAGACTCGGAGGAAATTCGCGATACCTGGGTTCGACATTCAGTTTTTGGTTGCTTATAATGGCACGAACAAGCTGCCATAGCTCG
TGGAAATACTTACGGAGGTGTGTTTGTCTTTTGACGGCGCAGGTGACGCATCTGCAGATGGTGTGCGAGGATAGCAACCCGAGTGACGAGACTGAAGAAG
AGGTGCAGTCTGGTTTGAAGTTCCGCAAGATGGTGGAGGATCGCGCTAAGAAGCAAGCGTACTGGGCGAAACGCACACAGGAGTTGGAGCAACGGaagca
agaagctgaagagcgaaagaagaagttcgCTGGCGTTGGGATGAAATACACTGCTCTTGCCATGAGCAACAGACCCGACTCATCGACCAAGGATTAAGGT
GGTGCAGCAAACAACTTCTTAACTTTGAGTGTGTGTTGATCAATTGGTAACCCGACGCAATGATTTCAATTGTTGTTGTCCTCGGTGATGCATTGTAGGC
GCTTAATTGCAGCGGACACGGTGCTCCTTCGTATTCTTCGTTGGTGTACACTCAAACAGATTGAATCCCAGCAGCTACGAAGTATtcgatgtacatgtat
gtttCATGGGAATTGCGTGCTACCGGCATCCTCTTTCAACTGTGACAACTTCTACAAAGGATGCGGTGCACAGGGTAGTGTACAGAGGTTGCCACTCGCA
TCATCGATGTTGCCACGCCAGGAACATGTGGGAAATGTTCACCACCTTGTGGATGAACAGGTCGTCACGCtggtccagcgtctccagacCAAGCGTATCG
CAGTGAGTGTTGACCACCGTCAAGTTCATGTACTGCGTCTCAATGTCGTTGCTCGTTTCAATTTCCGCATAGCGGTCAaagctggagctctgccACTCCA
TGCTGCGTTCATCAGCAGGAGAAGCAAAGAAGTGAGCCCACTCCAGCTTAAGGAGTTGGCCTTCCAACGGCGCTGGTCGTATGTTCATTGGACATTGGTC
ATTGTCCAGCAGACAATGGTTGACCTTGTCGTACACTGGAACGTAGATTTCTGCTGTGTAGAAGCTGCGGTTAACGAGTGTTGTTGAAATTGGGTCCTCT
CGTACTGTGTTCCCGAAGGTACTCGTTGAAATGAACGATAAAGTTTTTCTCTGAATGTGACATCGATCTGATCTGATTCAGCGAAGCGCGAAATTCAAGC
TGAAACGGGTGAAAAGCGTTCCACAGGACGATTTCATCTTCTTTGACTCCGCCGTTATCGCCACCAGTCCGTGCCCGCTTGCATGAGCCCGATCGATTAT
CTGGGCTGTGTGACCGACTCGGCAACACCGTTGCCTCACCAGACTGTGCCTGACCCAGTCGAAAGTTGCGGCGTTTTTCAAGCCCTTCACAGATCGTCTC
AAGGTCGAAACCCTCAGTGTTCAATGCCTCGAGTTGTTTCATGAGTTTGTCTCGCGCCACTCGACGCGCATCACGCCGGAGTATTGTTTTTCTCAGTGCG
ATTTCAATCTCTTCAACACTGGCCAATGGCGTAGGTTCGTCCTCTTCgctttcatcgtcatcacttcCGATATCTGCGGCAACCAAAGCCTGTTCCTGGC
GACTACGACTCGTTGATCTCTCCCGAGACTTTGATTTGGATTTGCTCCGTTTCTTCTCGTTGGAACTCGCCTTAGTCGAGCTCTTTGATTTAGGCGCCAA
AGAGACCGCAATAGGCGCTGCAACTATGTAGTAGTTCTGTAGCTCCTCTCGTCTCACTGATAAAGACCTCGATCGCTCTTGAGGTGCAGGGCCCGATCGC
CTCGCAGCCAGCTTAGACCGCGCTCGCTgtcgcgcagcttcatcctGTTCGCCACCCAAACTCGGCATGGGCTGAGCCCGCTCTAAGTGGCGTGCTGGAC
TGCGTCCTCTGCTCGGCTCCTGCCTCGCTTGACTCTGAACACTCGTAGATCTCTGATTACCGGTCTTGACGCCACAAGACCGTCCTCGAGGCGACGGCAA
CGCATTAGAAGCAGGAGtcagcggctgctgcagagatTGTCAATAATATTGGTGTTGGTAGTGCGGACTGCTGTAGGCTTGAGCGCTGTCATGTCGGCAC
AGTGCTTGGACCTGCGTCGACGCACAtggaagttgctggatccgtCAGCGGCTGGCATTGCTGACGCTTGTTCTAGGAGCGTTGAGGCGAAGTCTTCGAT
GTGGCGGGTGCTTGCTTATGTGAGACCAGTTCACTCCATACAAAAAGccagtacttcgaagtacagtaCTTGTATTAGCTATTGACCAAGTGTTACAAGC
CATGGAAGTCGCTCCGACGCTGGACGATGCACAAGCTCTCCGACAGCTAACGCTCGCAGATGAACATCTTGTACGTGAGCAGCAATGACGCGTTGGTTGC
CATTGGTGTGGGTATCGCTTGGCTTAATGTAGCTTCGGTATTTGATGCTGGCAGATGATCTGCTTGTGTGGAGTGGACGTGGAGCACGATCCCGAcgctc
gagtgctgcaggaggcggtGCAGAAGATCGTGCGCATTAAAATGCAAATGGGGACCAATGTGAGTGGCGACACAGTGCAGTCTGCTTGAGGATATTATAG
CTCACTGATCGCAAGcactgttgttgttgttgcagcacCAGATGAGCCTAGCTAGAGCACAGGGATCGAGACTTGTTGTTGAACAGGAGGTAGACAATTA
AAACTGGTGTTGAGCTTGCAATGATAGCGAGTCGCTGACGAGATGTGTGAAACAGTTCACGCGAAATGTGGATGCGCTGGCGGCGGCAGTGCCTGCGGTG
CTCAGCTCGGCTGATCATAATGACACGCTGGACGTAGATGCCCTCCTGGCTGATGCTACTCGCTACTTCGGCGCGCAACGAGATATGGTCGGACAGAATG
TCTTACACTGCGATGTTGATGAGTGCTAACACCGACCCTCGTTGCAAATAAAATGCAGGAGCGTCAGACCACTTCGTCTTTTCGCCTGTTGCTAGTCTAC
AGACATGTGAAACAGGTACGAAGCCACTTGTTGCTTGCTGGCGATGTAACTTATGCCTGATAGTGCAAACTTGTTCGTACAGAGCCCACAGCTCTACACC
ATCCAGAGAGAGGTGTTGGGTGGGTTTATCAATGAACCTGCTTGTCATTTGGACGCCATCTACTGGCATCAAGATGTCCCGCTAGAGGCAGCGCAGGTGC
TCCATTGTCAAAACCTCGCCTTGCTTGATATACGCTCACATTGCTGCTATTCTCTCAGAATGTGTTCGACCAGCTCTGCGCGTATGATAACACGAACCCG
TGGGCCAAGTTCTACTTCTTAGACGTCGGTGGATCAATCGAGAGATTGCACCAGGTACGCTTCGGTCATTTTTATTGTAAAACTCATGGTGTACATCGAG
AGGCACACGCAATTGGTCTGGAGAAACGTGGATGTCTAACACCCGTGTtgattgctgctggttggtcAGGCACTCGTACTGATGCTGTCGCATCCAGCAC
ATCGATTGAGTCAAAATGCTGCTGAACAGCTTCTGCGGTCGTGGTTTCACCCAGCAAAGGGGTCGACTCTCTAGGGCAGCAAGATTAAATAGATGAGCAG
GCCTGTTGTTGGTCCATACGAATGGGGCccgtccgtcgtcgtcagcgagGCAGGTGGCAGGGCGAAGAGGTTGCTAGCATGGTGCGCCATAGCGGAAGCC
GCCATTCCTCTCTTACGGTATATCCGCAAAAAAATCCGAGATGCCTTCGCTATCGTCCAGATTGAAGCAGAAATCTGGATCGGTCTGCTCAAAGATATAA
AGCGCAGCGCGAACCAGTGTTAATAGGAGGAACGACATGGTCGACCAGTCTCAAGTCTGTGATCTGAAGGCATAAGTAATTCAATACCTTTAGCGGCGCG
AGTTTGAAGATCccgctgtccgagtcgtATGATCTCTGCTGTGGAAGGTGCAAAGAGACAAGCAGGGATATAAGCACTTTTCCTTAAGGCAGCGCCCATG
AGGATTGAGCACCAAAAACCAACTCACCTGGTCCAAAGGAGGTGCAGGGCTATCAGGCGCTGCAAACGCTCCGGCTTCCTTTGCCGCTTCGTTGACAGCC
TCTGCCTCCTTTTCGTCAGCCATTCGCCGAACTAAATACACATCCACGGGTCCATCTGGAAACGAGATATCAATAAGGAAGGTGCCCATATACCCTGGCG
ACGGACTCGATAAGATGGATCGCAAATTGCAGCTTCTCATACCTGTAGACTTGAGGAAGACCTGAAATCGGCGTTTTCCAGCAGGCATACCCTCGTCAGG
GTCAGGCACTTCAAGTGTTGTTCCTGGAGGAGCCTTAACCGCCATGACGCTCTGGTCTGCGAAACTCTCTTGCCGTCGCATGTCGTCGTGTGTAACATAG
CAGAAGTTATCAAAACTGCCTTTGTCGaacgcttcttcttcatacAGACGTCGAATGTTCTGACTGACCATCTTGATATGCTGGTCATACTTGAGTTCCT
CTTGCCTAAGATCTGAAATGCTTTGTCGAAGGTGATCCATTCCTTGATAGCTGTCAGTGCCACCTGTAGGCCCACTAGCACCTCTGCATAACAACAAGCG
TCGGCAAACGCATCGTCACCGTTAGACCGATGGCACTGCAGTTGCTATAGCTGAGCTCGTTAGGTTCCACTTCACGTACTTCCAGTGAATATTGTTCTTG
GACGTCTTCTCAATGAGGCCGATGCCTTCCAGCACATTTGTGATGTCATATATTCGTCGTTTCTGTCGATATACAACAAATTAGTACGTAAAGCCACCAT
ACGCCAGAACGACCACGCTGTTTCGACACAACTCTCCGAGCAGTTGCAAGCGCATCTTACCTGAACGCCAAGCGATTCCGCTGCCGTGTTCAGGTCCAAG
TCCTTTGACGGAGCAGATTGGATCAGCTCCACGAACCTCTTGGTCAGCAGCCCTAATGAACTGTCGTATCTGCTCGCTGGAGATGGCTTCGGCCCTGCAG
CCAAGACAAAATGCGTCAGAACCACTCGACCGCACACGGTACTCTGCTCCCTCTGTCTGCATATTCATAGGCAATAGCGTAATAGAACGAACCCCTTGCA
CTGGGACTCGGCGACTGCAACTTGGGCGGCGCCACGGCGGACGCGAGTGATCTGGACGCGACTGCCGCGGCGTGGCCAGTGGAGACTACGGGCGACGCCA
TCGCGGCCTCGTACCGTGCCTTGGGGCGCTtgatcttgcgcttgagctcctcgttcGAAACCTTTGCCTTAGCCATCCCGTCCAGCTAACTGGAAGatcc
gccgctgctgctacttATCTCGCCCGGTCTGCTGTCCCTTGGCAGAGCTTCCGGTGGCTGCGTTTCAGTATTCAGTACGTGGGTGACCCATCATACGGCA
TACAGCATACCTATTTGGTGTCGGTACAACCTGCAGTATGCTTGAGCGCAAGAATATGCTTTACGCCGGGGAAATGTATGGCCGAAGTGCCACATCACCA
TAGTCGATCGGACAGCAAGTAGCTCGCTAGCATGGGCATctcaagcagcaccgccgccgccgctccAGAGCGCAAGGACTTGGAAGATGAGATGGTGCTG
AACGGTGCGTACtttttctgctgcagtggcggcCTGGTAGGATTGCGCGTGGTTGGCTGCGTATTGACGTGAGGAATACCGTGAACGCGGGCAGACCTCC
ATATCGAGACGGGCGACCAGAATGCCGTCAAGaacctgctggacgacgctaTCGTGGAGTTCTttcaggagaaggaggatTTCAAGCTGCACTATGGATG
GGAcaacgccaagctg