Description :
From Genome Similarity Track
Location :
scaffold_1005:5523- 7798
Transcript NameFunction/comments
Pl_101585hypothetical protein PHYSODRAFT_547793
Pl_101586hypothetical protein PHYSODRAFT_336386

Sequence
2275 bases(100 bases per row)
ACTCGGGTAAATACTGCTTCGGTGTAAGTGACACGATGAAGGCTCTGGATCTTGGTGCCGTAGAGACACTGATTCTATGGGAGGACCTGCCGCACCACCG
CTATGTGCTGCGCAATGAGGCCACGGGCGCGGAGTCGGTGAAAATCTTATCGCCATCGGAGGAGACCGTGGACTCGAACTTCCTCGACTCGGAAACGGGA
GCCAAGCTGGAGACTGTGGAGCGTGTGCCGCTTGTGGAATGGTTCGCTAACAACTACAAGCAGTTTGGTACGACGCTAGAGTTCGTGACGGCTCGTTCGC
AGGAAGGTTCGCAGTTCTGCCAGGGTTTTGGTGGTATTGGCGGCATTCTCCGATGGAAGGTGGACTTCATGGAGATGGACTACGACGATTTCGACGACGA
CGACTCCGACTTTGACGAGGACGCGTTCATGTAGAAGTAATTATTGCGTGACGCTTTGCGCTTAGTTAGGAAAAAGCGTCACGCACCGTGGCGCTGCGGA
GGAACGAGCGCAACCTGACAAAGAAGAACTGCATTTTAGTGCAGCTGTCCATGAAGGGGATGTCGCTATAGATTTTCGAGCAGAGAGGAGCAGTACAGCG
GCTGAACCGGACGAGCTAGTGAAGCGAGGAATACACGACAGATTCCATGCTGACTTTCCTCGCATCTTCGAGTGCGTGGTCTGCCATCTAGGCGAACGCG
ATTGGGTGGTCACTAACCTGTTGTGATGAGCAGCCCAGTTTAGGTGACGCTTTATCTGACAGACGAAGAGACGCGTAAGTATATGTAGACACGATGGGGG
ACGAATCGAGGGAGACCCCTGTTGAACGCATGGAAGGCAACGTGGATGAGGTGCAGGAGGCACGGGAACAGGAAGCAGCAGCATGTTTGCAGCGGATGTT
CCGTTGCCGCAAGGCAAGACTGCGATTGCGTCAAATGCTGGCGTCCGTGTTCGAGAAGTTTTACGATGCCGACTCGGGGCTCTATTACTACTTGGACAAA
CGCACAGGCGAGACAACGTGGGAGAAACCTTGTGTGCTACGTGGTGACGATGATATTGAGTTAACGGCTGTGTACGAGGGAAAAGAGGAGGCGACATCAG
AAGCTGAGCCGACTGGGGAGACAAATGCACTGGAAGTTGTTGATCTGGATAAGGATGACGACAAAACTGCGAATGAAGAAAAGGATGATAAAGAAAACGT
AGGAGGCGAAGAAGCTGACGAGAACTACCTTGGGTACTCGCCACATGATCTGGTAGCCGCTCGGGAACAATTTGCACACTACGACACCGACTCAAGCGGA
TCTATTAACGCCACAGAGATGCACAAACTGCTCATCAACCTTGGCGAACAACTTACATTAAACAACGTGCGTGAACTCATTAAATCAGTCGACACAGACG
GAAACGGCGAGGTGGACTTTGACGAGTTTCTCCATTTATTACGCAAACAGCAGGACAAGAATCAGTACTCGGTGTCGTTGACACTAGCTCTGCTCTTCGG
ACCAAAGGAGCTGACCAAGCTCAAACAGCAGTTCATGGTACTGGACTTGGACAGCAGTGGAGCCATCGATGAGCAAGAACTGCAACAGTTCGTAAAAAAG
CTAGGCCGTCGAGCAGATGAGTTCGACTTGCCAGCCATGCTGCGTGAGGTTGATGACGATGGTAGCGGCACGATCGGATTCAACGAGTTTTTGCAAATCG
TGGCTAACATGACAAAGAACGATGGCAGCGACCCCAAATCAGCTTTTGCTGCATTACTAGATCTAGGCATTGCGCAAGGCATGCTCAAAGGGCTGGACGA
GGTTGTGCAAGCTTCGCGCCAGAAGATTTACGAGTGGCTTAATTCTGACCTTATTGCCGAGCAAAAACGGCTTCAGGGGAAGCGTGAACGTCGTAGACGG
CAAGAAGAAGAGCGGAAACGTGAACTTGCCAAAGACCGCGAGCTGTATGCGAAGCACCAAGCAGATTTAGCTGCTATCGAGCGTGCCCGCAATGCCCCGA
TAGAAGGTCTAGCTATCGACGTAGAGTTCGAAGGTGATGGTCGCAATTTCCCGGTTGCTGGACAATTCGCTCGAGTGCACTACGTCGGCAGCTTCGAGCG
CACAGGTGAGGTCTTTGAATCAACTCGAGTACGATGCGGTAGTGCGCTTGAGTTTTGCGTGGGTGCTGGACACACTATTCGAGGCTTTGACCTAGCTTTG
CAGCGCATGAGTGTTGGTGAGACGGCTCGGGTTACTATCGCTCCTGCGTTGGCCTACGGTGTGAAAGGCAGACCG