Description :
From Genome Similarity Track
Location :
Scaffold_93:55221- 60506
Transcript NameFunction/comments
Phymu_g4098callose synthase, putative

Sequence
5285 bases(100 bases per row)
CGAGCTGCTACAGGCCAAGTTCGGCTTCCAACGCAGCAGTGTGGCTAACCAGAAAGAGAATTTAGGCTGCTGGATCACGAATTACCAGATGCGGGTGCGC
TCCGAAGCCCCGCAAGGCGCCGCCGAGAGCGCGGACTTTGTCACTCGCTCGGCGCTCACCCGCGTGCACAAGAAATTCTTTAAAAACTACGTCATGTGGT
GCAAATTTCTCCGTACGCCACAGCGCTGCTCGGACCCGGAGAAGGAAAATACGgtcaagatggagaaggaactggcgctgttcctgttgctgtggGGGGA
AGCCGGCAATCTCCGCTTTATGCCCGAGTGCATTTGCTTCCTGTACCACAATATGGCCGCCAAGATGGAGTTTTTAGACACTTTGCCAAATGTGGCCGAG
GGATTTTACCTCAACGAGATCGTGCGACCCGTGTACCACGTCATTGCCCAGATGAGACTGGCGACGGCCCCAAAAGGACAGCGGCCGTTCGACCACCAAG
ACACGACCAATTACGACGATGTGAACGAGTTTTTCTGGATGGCGCAGTGTCTCGAGTGTGACGAGATGAACGTGGCGAAAATGCTGGAGGTGCACGACCA
CAAGACGTTCAAGGAGAAACGAAGCGTGTTTAACCCCgtgctggccttcttccGGGTCTGGTACTTTTTAGTGGTCGTGTTCCACATTATGGTAGTCATC
ACGTACGTCTCGTACATGTccgaaggagacgacgacggaggactggccttcttcttccggaTCTTCAATAGCGGACAGAACAAGATCCGAGCGCACGCGT
TCTACTCGATCTTCATTACGATCGCCGGACTGCTGGCCATGAAGGTGGTTATGCAGATCTGGCTCTTCGGATTGAGACTGTACAAGGATATCTGGATGGC
AGTGGGCGTGTTCTGCCGCTTGTTCTGGcacaccttcttcttcgctctgTTCACGGCCGTTTTCTTCTCGCCCGATGAGTCTGCATTGTTTGGATCACTG
AGCAGTATGTTGCCAGGAGGAGGCACCGCCGGATCGTACTTGTCCATGGGGCTGGTGTACATTATGATTTACTGCATCCCCGTGttgacggcagcgacga
tgCGTGCGTTCTTCCCGAATGCAATTTGGGGGATTCGAATGGTGAACGCACTGGATGGCACGAGTCGGCAGTACGTGGGACGCAACACAGCGCAGCCGTG
GGGAAATTACACCCAGTACACGATGTCTTGGTACATTATCTTCTTTGGCAAGTTCCTGTTCGCGCTGCAGTTCATGATCCGCCCTCTGATGGCGCCGTCG
GTCGAGATTTATGATATTGTGGTTGATGACGATGGAGTCCTCCAGTCGGGACACAACATCATGTTCATCCTCGCTCTGTGGGCTCCGATTTTCgtcgtgt
acatgtacgacacGCAGATTTGGTTCATTCTCTACCAGTCGATCGTCGGTCTGGTTATGGGCAAACGCATGCACATTGGCCACTACGTTGGCTTGGCCCA
GCTGAAGGTCGGAATGGCGGCAGCTCCCAAGTTGTTTGACGATAAAGTCGTATCACTGAGGACCAAGAAGCCCAATCCGAACGCAGTGACGCCTGTTCCT
GGTGatggtgacgctggtgaGTTACGTCACCATGATGTTGTACGCCTTCGCTTTGCCATTATCTGGAACCAAGTGGTGGACAACTTCCGCTTGAACGATC
TGCTAGACGACCGTGAAACTGTTATTCTGCACTACCGTATTCTGAACAAGGGGGAGCGTATCCAGGAGCCAATTTTCCTGCTGGCTGGCAAGTTGTCAAA
GGCCGTCGAGGTCGCAGCCAAGTCACGTACGAACAAGTGGGACACCGCGACGTTGGTCAAGAACATCGCTACTGCTGACGCGCTGGAAGGGATGAAGAAC
GGCATGGAGCTCATCCGTGACATCTTCTACTTGCTTCTaggacaggaagaagagaagggTGCGTTGAGCGTGTTGGAGTACATTTACTCGTCTCCGGACA
TCGTGAACCTGCTGGACTTGACCTACCTCCCCCAGCTATCAACGAACATGGTCGAGCTCCTTGCCGTGATCTTGGACATGCCAGAGGACATCGCAACAAT
CGATGACTTGAGCTCTGTCCCAGAGGAGCTGCGCAtggagctgcacgtgcaAGTGGCTCAAGTGGTTGATCGTCTCCGGGCGATCGCCTTGACTctggag
ctgatgctgcaggaCGACACGGTCTCGCGTAAGCTGCACAACTGCCGCTTCCTGCAGACCACAGCTGACCTGGAGTTCCAGACCAAGCAACTAATTTACC
TGTATCAGGCTGATGCTATGGTAGAAACTGGCCTGATCGCTGTGCACGCCGACGGACAATCTGCTACCCCAGGGCCGCGCTTTGCTCCGGAAGAGTTCAT
TTCCAGCTGCACacgcttgttcttcttgctttgcCTGGATGTCGCGAGCTCCCTTCCCCGTTGCGAAGACGCTAAGCGTCGGATGGGATTTTTCCTGCAC
TCACTGTCAATGGAGATGCCGCGCGTGGACTCGTTGGAGGCGATGCCGTCGTTCTCCGTGATGACCCCTTACTACTCTGAAACTGTGCTATTCACGCTGG
ATGAGCTGAACAACCCGGTTCACTCGAATCCCCTCTTTGccgagctcgagaagaagcagaaggccaagggTTGGACGGAGCTGACAATCATGAAGTATCT
GATCACGTTCCACGCCGAAGAATGGAGTAACTTTCTGGAGAGAATGGGTGCTTCGTCCCTagaggaggcgctggacgtcAACGCACAGGAGGTACGTCTA
TGGGCATCCATGCGTGGCCAGACACTAGCGCGTACAGTGCATGGTATGATGCTGTACGAAGATGCCATCCGTCTTCTCCGTTGGCTGGAGATTTTCTCTC
TTCGTGATATGAGTATCCAAGAGaaactggacgagatgaaccGCATTTCAGCTCTGAAGTTTTCGTATATCACAGGCTGCCAGATTTACTCCAAGCAGGT
AGCGAATGGCGACCCCCGTGCGGCGGATATCGACTacttgatgaagaagttcccCAGCTGGCGAGTCAGCTTCGTGGATTCCATCACCGAAAAGGAcggc
gagaaggagatcaacCGTTTTGACTGCGTGCTTGTGAAGTCTGAAGGCGGTGAAATTGTCGAGGTGTACCGCTACGAGCTGCCTGGTAACCCGATTCTTG
GCGAGGGTAAGCCCGAGAATCAGAACGTGGCGCTTCCCTTCACGCGGGGCGAGTACCTCCAGACGATCGATATGAACCAGGAGCACTATTTGGAGGAGTG
TCTGAAGATGCCCAACTTCCTGGCGACTGCTACAAGTACCGGCGAAGAAGTGACTGTCATCGGTATGAAGGAACACGTGTTCACAGGCCGCGCTTCGTCG
CTCGCTCGATTCATGACGCTTCAGGAGCTGGTGTTCGTGACGCTGACCCAACGTGTGCTGGCCAAGCCGCTTCGCTCGCGTATGCACTACGGCCACCCTG
ATGTCTTCGAAAAGTCTTTTGTTGTCACGAGTGGTGGCGTATCCAAGGCTAGTAAGGGAATCAACCTGTCTGAAGATGTCTTCAGCGGCTATAACGTCAC
CCTTCGCGGTGGTTTGGTGACGCACGTGGAGTTCATGCAGTGCGGTAAGGGCCGAGATGTGACGTTGAGTCAGATCAACGCTTTCGAGGCGAAGCTGTCG
AACGGTTGTGCTGAAAGTTGTCTAAGTCGTGAGGGTCACCGCTTGACCAATTCGTTGGATTTCTCGCGGTTGAACTCGATGTTCTACGGCCACTTTGGCT
TCTACATTTGCAATGCTCTCACAGTCTTCTGCGTCTACGTCTACGCGTACTGCAAGCTCTACGTTGCGACGCATTCGGAAGTGGAGGTCACAGCTATCAT
GACGACGGGCAGTCTCAACTCGCTTGCCAGTGTGATGACGACGCAGTATCTACTCCAGTTCGGTATGTTGACGACGCTCCCTCTGTTCGCGACCCTGTTC
GTTGAATTTGGCTTCAAGCAGGCGTCACTGAAGGTGATTGAGCTGATCTCGACTCTTGGTATTGTGTTCTACGTGTTCTTGACTGGCACGAAAGCGCATT
TCTACGATGTGGCTCTGATTCGAGGCGGCTCCAAGTACCGCGGCACTGGCCGTGGTTTCTCCATTACCCGCGACCCGATGGTGAACTTCTTCAAGGAGTA
CGGTGTTTCCCACTTCCGCAAGGCCGTGGAACTGATCGGTGTGATGATTCTGTTTGGCATCTACGGCTCATTCGACATTGGTTCTGATGTACTGGAAGAG
TACTGTGCCACTGCGGACTTCGACTGTGACAAGGATCCTGACCAGATCCCCGCGAATATCACTTCACTAGCAGCCTTCAGTAACAAGTCGCAGAGTTACG
GCATTGCTTCCTTTgccgtgctgttcctcgGCGCGTGCTGGCTCATGGCTCctttcgtcttcaacacggACGGTTTGGTTCTTCAAAAGTCGAAGGTTGA
TATCGCTAACTGGTTCGCTTGGATGATGCGCTCGCGCCACaaggacgacggcaacgacgaagaaacgACCAAGGACGCAAGCAGTGCTACTCTGCAGCCC
AAGGACGGTTGGGACGACTGGTGGAAGTCGGACGTTGACTTGATGCTGCCGCTGGGCTTCATGGGCCGCCTTACCTACTGCATCCGTGAGTTGCGCCACC
CCCTGGCAATGTACTACGTATTCCTGACAGAGTTCACGCTGCCGTGGTTCGCTCTACTGTTTGGAGCCATGGGCGCTACGTGGGCACTGCTGTGGTTCGG
CAACCGCGTGCACCACTGTGTATCCAAGCACCGTAAACTCAACTCGCTGACTATCCAAGGCATTCTGTACATGGTGTGTGTCATCGGTGGAATGATGCTG
ATCCCGCTGATTCTTGGCGCTATGGGCGGCTGGTCTGTACTCAAGTGCTTCACGTTTTCCATCGCAATGATTCTGGGTTTCAATGCGATTGTCCAGTACG
CTCTCGCGTTCAACGGTGTCTTCGGAATGGAAGTGGCTATGTGGAGCCCCATGATGGCTCTTGGTTTCCTCATGGATATGCTTGTGGGTCTGTTCCTAGT
CATCCCGTTGTTCCTGCTGTCCCTCCTGCCTTTCATGCGCATTCTTCAGACGCGTGCAATGTACAACGGCGGTTTCTCGCGCGCTTTGAGCTCTGGCTCT
GAGGTAGCGGCTTCACTGGTCATCCTGCTTGGTGTGCTGGGCGGCTTCATCCACGGCTTCATGTCTTCGTTCGTGTACACGCTTG