Description :
From Genome Similarity Track
Location :
Scaffold_42:55221- 58498
Sequence
3277 bases(100 bases per row)
TAGTAATCTCCGTCTGGAGATTTGTTGGTTCTTTGCGCATTCACTTGGTTTAGTGTTGTGGCTCTGGTTCGCTTTCCAGATCCACGGCGGTGTTATCCGA
GTTTGTTCGCTGTGTTAATAATTCTTCGAGTTTAGTCCATACTCCAATTGTATCATCTTGATGGATCGTGGAGTTGATGTCTGAATTAGACTGCATGACT
TCAAAGAGTAAATCGAGATACTCGATCGTTGTTGTTTGGTGTTGGCATCCTGGTTTATTGGACAATCGTCTGAGTTCATTCACATATACATGGGCTACAA
TAATCATGCGAGTGAGGAATTTCAATCGACCCTTGCTGCAGAGTTTAAGTAGTTCCATGTCTCCATATTTCATCAATTTGAGTTCCCTCCAAAGTTCAGC
TGGAAATAGGTTAAGTTGTTCCTGGTTAATCGAAGCTTGTTGTTGGAGCTCAGTACTACATACCTCCAGCCATGTCCCTTGTTCTGTGTTCCCTTTTCCT
TTCATTATTTCCGCAAGTTGCCCAAGGCAGTGGGTAAGGCATTCTAATCTGGCTGTAGTGGTCCATGTGTCGAGAATCGCATCAGTCATCGTTGAGAGAA
TAAAAGCAGGGGATTGGTAGGTCTGGAGTGCTGAGAGAAGTGCCCCCGGTGCTTGTGTGACTGCTGGTTTCCAAGTTTCGGATGTTGCAGGTAGTATGGG
AAATTTCGCTAGTGTCGCTTGTTCCCAATTAATTGCCTGCTTCAACCACAGTTTCCGAAGTTCTTTTTGTCGTGTCCTGCTGGAGCTGATAGTAGCTGCT
GGTTTATCAAACCTGCTTGGTTCTTGGTTTTGAGGGCGGATAGTTGTACTGTCCAGTGGGTCTGGTAGTAGTTCTGGGTCGTCTTGTTCCCATGTTGATT
CGTTCGACGGTGGTTCGCTCGATTGCGTCGATGTGAAGGTTGATGATGGTCCTTGATCGAGCAGCTCCATTTGCCATTGCTTCAGTGTTGTTTGGTCTAC
CTCGTATCTTTTCATCCATTCATTCACTGCGGCTTCATCCGTCCACTGTAGCTCTCGTAAATCTTGTCTCCGTCCTGGTGCAATTCCATCAATTCCAGAA
GTTGAGAATACTCGAAGTTCCTCTTCACGTCCTTGGCCGTAGATTTTCTCCTCATTGCGCTCCTGTGCCTCTGTTGCTGTCAATGGGGGTTTGGGCTCCT
GGTTTGTTGATAGTGGCTCTGAAGGTTTTTTTACTTCATTGTTTTCAGCCAGGTCCATTCCTTCGTCCTCTGAAGTGACTTCCATTGGTTCAGCGGTGTT
GTGGATGTTAAGGTTGCTCTGTAGAGAGGCTTTAGGGTTGAATTGAAGGTGGCTATAATGTTTTGGTCGGAATAGCAGTACTATGGGTAGTTCGTCCGGT
GATTCTCTGTTCTTGCAGTCCTGTCGAATCTGATTGATCCATTGTTGGGCTTGTTTTGCTTCGTAATTTCGTTCTTTGGCCGTACTGTACTTGTTTCCTG
ATTTGGTTACCTGCGCTGGCGTGAATTGCTGGTATGTGGCCTGGGCTAGCCCTGGTCTAGCTACGACCACAAATATGTTGCGGTGCAGGATCTTTGCTAA
CATTCGTAGTGTTTCATCAGTTCCCCAGTGGCGTCCCGAAATGTATCCGCTTCGTCGTGAGTCTGACTTTCCCAGGTCAATGAAGTGTGTTTTCAGTGCT
TGTTCGGATTGCTCCGGAGAAAGTTGTTGTGGTGTTCGCTCCACTGCAGTTAAAATCTTGAGTCGTGAATCGTGTTCAAATTCTTCGTTGAAGAAGTGTT
CGCTTGCTGCTACGAGGCCTTTCTTGAGTTTACCAGTGATGGTTTCGAGTGGTTTTATGCTGTTCGTTTCTTTGAAGTTTCTGTTGAGTAGTGCAGATGC
GGCTGCATAGTATTGGCAGTTGCCATTGTCTGGTGTCGACGTCTCTTCCAATCCACATTCCTTAAGGACCTGCTGTCCTGTCATCGTTGTTTCATCACAC
TGGTCCAGGTTAAGGCCAGCTATTTTTTCTAGAGCTTGTTTGTTGGCTGGTTGTCTGCGTTCAGCAATGAGCTTGTTGATTAGGCCTCGTTGCGACTGCA
TTCGTTGAGTTCGTTGGCTTAATGTTTCGCGGATAATTTCTGCTGGTGAAGTTTCCCTGGTTGGAGTGATCGGGTGAGGAGGGTACTCCATGTTATTTGC
TATGGAATTGTTCTCGTCGCTGTGCTCTGTCGCCAGCACTGGTCCTCTTTTTTCGTCTTGCTGTACATTAAAACGATGTCCCTTGTTAGTTCCTACCGTT
TGCCATTCGTTCTTACCTGGTTCAGGATCTTTTGGCGTGATTGATGTACGTGATGCTGTTGCAGCTGTCGTGTGGGTCCTAGTAGATCGATTTTCAGTTG
ACCGTCGATTTAGCTGTGTCAGTGGGAGCACTGGCATTTCTGGTTCTTGCTCTTCATCTATCCAGTACTTCGTCATTTCCTCAAAGCTGATGACAGTGCG
CTGTTGTCTTGGTAGCGTTGTGATGTCTTCTGCTGAAACTTGGATGCAGTACTCCGAAGTGTACCAGTAGTCATCCTGAGCGTTACATCTGTTGCGCGTG
TGACCAATTGCACCACATTGGAAACATGGAGGGGCTGGTTTCACGTTGACATGGTGAATTAGGATCTTTGTTCCATTCCAGTTCAGGAATCTGCGGTCTA
CTAGGAAAGTAGGACATAGTTGGCTCTTGAAGTAGATATCCCAGGTATCAGTTTGCCTCTCGTGTGTTTCTGATGATGGTTCCTGCCACGTCGTGTACAC
ACCTGTAAAGTGCTGCTGTAGGAATGCGTTCAATGCTGCTTCATCCATGAACCTCGACACGTTGAGGAATCGAACATGGTATCGGTCTCTCGGTTTCTCA
TCACGTACTCCATCTGCTCCCATTTGTCTCGCCCAGACTCCAGCTGAGTGGTGATTTAGTGATTCTACTAGCTCAACAGGGGTTGAGTGTTCATTGCGGA
GTGTGAAATTCTTGTGGCGGAACGGTAGAGTTGTAAATTCGTTGCCCCACTGTGTCGCCTGCTCTCTCGTCCAAAATATTAGGTGGACAGCATGTTGGGC
ACGATCATAGCAGACTTGTTTTGCGCTTTTTAAAAGCGCCACAATACGTTCTTCAGGGTGTTTACTTCTGCGCTTTCCAAGCAGTATCATGCCTACCAGT
CTTTCTCTTGATTGGAAATCTGGGTAGACAGGAAAATCTGGGGGTAGTTGGATCACTAGGTCTCCTTCAACTTGAGC