Description :
From Genome Similarity Track
Location :
Scaffold_1307:5522- 7223
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1307-snap-gene-0.3Calcineurin-like phosphoesterase

Sequence
1701 bases(100 bases per row)
CATAGTTACTCCAGGATCGTGATGCGACCTTCGCGCTCTGAGTACGAGATCAGGCGCTTCTTCATCATGAAGTCCGCCACAATGACCGGGATCTTGTCGG
CGATCCGGATCACTTCGCCCCGCAGCCACTCGCTGATACCGTCGCCNNNNNNNNNNNNNNNNNNNNNNAACGAACTTGGACGTCGCGACGAGCACCGAAG
CGTCCAGGTCGATGTCCTGCCCCTGTTCGTCCTTGAACTCGGAGATCGTCGGCTCCGACGGGTTCGTCTGTCTGTCCAGCGTCACGCGAAGCCCCGAAAT
GTGTGGGTGCGAGCCCGAGAGCTGCGGGTACTTGGCAAAGTGCTTCAGGATCGCGTCTCGAAAGTCGCGTGCCTGGATGCGCACGACCACCGCGGGACGA
GGGAATGGCATCTCCTGGCCGAGGATGCCCACTGTCACGTTCGTTCTCGCCGCGTAGGATTTATCGCCGCGGATAAAACCGCCGTTGACCAGTCCAAAGT
CCGTCGCGAGCTCACTGCGCAGCGCGTCCGCAACGAGGTTGCCCATGTTGCACTCCCCCGAGCGCAGCAGTGACGTCTTTGTGAACAGCGGGAGCGCCAG
AGTCGCGAGCACGCGGGCATTTTCTCGCGCGCTCTCTTCGGTTTCCATCGATTCCATGTACTTGTGCACGATCTTCTGGCACTCGGGCTGCGGCGGCGTG
TGCTGGTTCGTGAGCATCGTCCACTGCGGACAGATCGCGAGCGGTCTCTCCGGGTGCTTTGTGGACTTGGAAATGTGGAACTCGAGCTTCGCGAGCCAGA
AGGCGTTTTGCCCCGACTTGTGAATGAACGTCTTGCCTTCGTACAGCGTGAATGGTTCGTGGTCGTGGCCGCCGATCATGACATCGATGCCGGACACTTT
GCGCGCCAGCAGCTTGTCCTGCGCGATGCTGAGGTGCGTCAGCGCGATGATGAAGTCCGCGCCTTGGGCCTGCAGCTCCTTGATGCAGCGCTTGGAGGTG
CTGAACACGTCTTGGAACAGCACCTCGGGTCCCGGGAACGACAGACTCGGCGTCTCCTGCGTGCAGATACCAAAGACGCCGAGCTTGAGGCCGTCGCTGA
GCTCGATGATCTCCGTGTCGATGACGTGATCAAAGAGCTTCTCCGTGGCCGCGTCACGCACGTTCGAGCCAAACCACTTGAACTTGGACTCCTGCATACG
CTGCTTCAAGATCTGCGAGCCAAAGTCAAACTCGTGGTTACCCAGCACCACGTACTCGATGCCCAGGTGGTTCATCAGCTCAATCATGTGTGCGCTGCAA
GCCATACAATAGTCAAGAATGCGCGTTAGTATAACCATCGGTCACCACCATAATGAGACGCGCATAACAACAATACACACAGCACGTACCCCTTGTGTCG
TTCACCCACCTCGGACCCAGACAGGAAGTCGCCGTTGAGCGTCACTAGCAGCTTCACGTCCTGCGGCAGCGACGCCTTCTCGCGCTCCAGCAGCGTCGCC
AGCTCCGCGATGCCTACCACACACAAAAATCGCGTCAATATTATTTAGCTCTGCAATGACACTCCAACTGTCGTCACGCAAGAGCTCTTCGTACCGCCGC
GGCCCTGTTCGTTCGGGTACATGTCGTAGACGTCGTTGACCGAGAGCACGACAATCGTGGCGGCGCGGTCGCTCTCGTCCTGCTTCTGACGCCAGTTGCT
G