Description :
From Genome Similarity Track
Location :
Scaffold_221:55212- 63623
Transcript NameFunction/comments
g14877.t1hypothetical protein
g14878.t1ETL36420.1 hypothetical protein L916_11592 [Phytophthora parasitica

Sequence
8411 bases(100 bases per row)
ACAACGTCGAGGCGCTGCTGGCCAGACACAACAAGAAGTTCAAGGCCATGCACACGTACGAGCCCCCGCGGCACTCGGTCCGGGAAGTGAAGCAGGTGAG
ATATGAGTTTTTAGTACTTGTTGGAGACTTTTTACTGACATTATTTTTTAGTGGGAACGCGAGATGAAAAGGTCTTATTATGCTTTGTCAGCCGAGGAGA
GGGTGCAGGCAAACCAGGAGATTGCAGTCTGGAAGAAGCGACGAGTGGGGACGACCCACTAGAGAAGTTGGAGACGACAATTGTAAAGTTAGTTGATTTT
TATCTCGTCTCACATTGTTGTTGACTAGGTGTCTAGCATACAGAGCATTGCACAGCCACGGCGGATCCAGTGGTCGGGGCTTTTGTCTGTGGGAACGTCA
AGAGCGACGACAAAGTTGGTGGAGTGGCCTGTGGTGGAGAGTGTGCCGGCGCGGATGGAGGTCTTGTACAGCGGGCACTCGTACACGTCCGATGGCTTGT
ACTCTTCTCGTCGCATGGGCTTGAGCCAGATAACAGGCATGCGATCGAAGAGTTCGTTCGGAATGGACTCGGCCATCATTCTCGTGTTGCGGTCATAGCG
CGCACCTTCCATGAAGAGCCCGAAGATGTACACGCCGAAAGGCGGCGCAGCTTTGTACTTCTCTTTGTCCTGTGCCATGATCTCGCACGAGACAACGAGC
GCGTCAATGGCGATTTTCTTGTCTCGAGAGAATGACTGCTTGACGGCTGTCATGAAGCCCTGTGGAAAGAAAAAGCCTGACAGCCAGAAACTCAACGGCG
GTCCTTGTACGAGCCAGTCGTTGGTCAACGTGATTCGTATGACGAAGTCTTCTATCCAAGAGGCCAACGGCTTCAGGCACGGATATCCAGCATTCTCCCA
CTCGCTTGGAATTTGCTGGATCAAAAACCCGTTGTACATTTTCTCGAGCGGACCAGACATGACCACCAGCCCCTTGATCGCACGCTTGAGCATCTCAAGT
GTCGTTTTCATGACTTGAATCAGCACATTGAAGCGGATCATCTCCTGCGACAGGAACACGCCCAGTGAGTTACGACTACCGCCTGCTGCTTCTTGGAAGG
TCGATGGGTGCGCCTTGCTCTCCATGAACGCATCGGGCATGCGTTCTTGGATCGCTAGCACCATCTCCATAACAATGCTGTCATTACTCTGCGCGGCACC
GCCGCCGCCGCTATCGCCACCTCCACCCAGCATCTTCAATATCGTGCCCAGCAGCTGACCAGTTTCCTTTTGCTGGAATGTGATGTCTGCGTTGGCGTGA
AGACCGAAGATGTCAGGGGCATCTGCTGTAGGCAGTGAGCTCACGTACTCGCGGACAGTAACCAGAGAGCCTTCGACTGGCGCATAGTAGAGTCCCGAGG
TGGTGAACTTGTACGAGTCGTCCATGACTCCTTTGCAGAAGAGCTTGCGCATGATACTCGAGTTCGTTCGCTTGTCCCAGCGGTCCGTTATGCGACCACC
GTAGGAAATGTCCGCTACCATGACGTTCAGCGTCAGGTACGGCACCTCTTCCTGTTCCTCCAGATACAGCCGCACCTGCTGCATTCCTGTCTTTAAGTCG
CTGTTCATCCACTCGTACGGGATGTTCCAGCCAACAGCACCAAACTTGCGTCGCTCAAGACACACAGCGTTGTAGAAGGCTAGCGCGAATAGCAGCTTCT
TGAACTCACGCGGCTTCGTGCAGCCTTCGAAATCGGCCTCTTTCATGTCAAGGAACGTACGTCCTAGGTTTGCCTTGATACCCTTCGGAGGCTCATTCGT
GATCTTGATTCCATTCTGCAGGATAGGCACGGGGAACCGAGAACTTGGCATACTGGTGAGCCACAGCCTAAACTCCTCGTGCATCTCCTCCGTCGCTGAT
TGCTCCAAGATCTGCTCAAGCCGTCCTAGCCATGATACAGCCAAATGACAGTTTTGCAGACACACCCAATCACCCGTCTGTTTAGCTTGTTTCATGAGAG
CTTCAGCAATCGGGCCTTGGCCTTGCCCAAGCGAAATAATCTTCAGACCAGCTCCATCTTTGCCTTCTTGTTTGGCGAGCTCCAAAAGGTAGTCGTTGAT
ATCGGCGCCCGGTGAAAGTACGAAGATCAGCGGTGTCTCCGGCTTTGAGTCTCGATAACAGCCACCAAGGTCGAACGGTGGAGACTCGGTGAAGAATTTA
CCCAGCTCACGCCCGACGAACTCGCGCGTTCCAAAGACGAGCATTTCCTCTCGGAAGACGCGCAAGATTAGCAGCTTTTGGAAGTTCGTAAGCGTCGATT
CCCAGGGTTCCGGTAGTGCTTCGGCATGCGGTAAGTCGGCCAGAACCATTGCACGTTTCCACTCCGTTGCGTGCTGTCCAACGGACGAGGCCAGGTCAGT
AAATGCCGGAGAAGTATCCTTCATACCAACGACAGTCTTCCACACCCTGTCAGACAGCCAAGACGGACGCGTAAGACCACACGATTCAGCCTGTGCGGCT
TGAACGGCTGAACTTCTCTTATCGCCCATCAGGTAAAAGTTCCATTCGCTGGAAGAGATCGCCCCGCGATGTAAAAGAATACTTGATGCGATCATAAACG
CGTAAATTATCTTGTCTTTCTCGAACAGCCCGCGACAAACGTTTACAAACATGGATACGGTGATATCCTGCATGAGAATCTCCAACCGTTCTTCCAGCAC
TTCGGACTTGGTCGAGTTTTGAAGTCGCATCACGAATAGCTTCTGGTAGAACTGCAGCGAATACTGGTACATGGGGTCCACAAGCGCAAGATTCGCGATT
GCGAAGTAGATAATCGACCCACGTACAGCAACACAGCGGTACCCTTCACGAGTTTGGTCGATCTCCAAGGATGTCGTCTCTGCCTCAGCCATACGAGTCT
TAATCGCAGAAGATGTTACCTTACTGTGAGCTAGTGTGTCGATGAGCTCTTCATCATCCAAAATGTTTCCCTTGGAGTTCTCAAGCATGTACAGAATCTT
GTCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCATTCTTCTTCTGCTCTAGGTCAGGACGCTCACTTCGCACAACGTCC
ACCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTGATGCAGATCTCAGGCATGTAATGCGGGTTTGCAAGCTTTG
TGGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGCTTGAACACTTGCTTCAATAGCAC
GGGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCAACGTACGCAGGAAGTCCTTTTGC
GATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTGTACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATCGATCATAAGCGGCCAGCGGCGCC
CCATGGTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACAACGGGGTCGGCTAGCACGCGCTG
GAAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGTATTCCGATGTAAATGGGCCAAGG
TACGCGATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTCTTTCCAACGGCCTTGCTCCTCGC
CCAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTCTTCTTTTGGGCATCCTCAAGTGT
TCGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTTCGAGTCGCTGCTCGGCTGCCTTA
AGGTTCTCCTTCTTTGGAGCAATGTTCTTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGATGTTGCAGCGGTGGAGATACTGC
TCAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCCTTGTCGAACTCTTTGAGTTTGTC
CAGAAACTTCATATCGTTAAGCAGCTTTTTGGCCTCATTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGTTCATTGTGACACCCACAAGTCTC
GGGGGATTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATATGCGGGCATAGCTTCATCCAAGT
CCTTCTGACAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGTTGTTGCTGTTTGTCAGCTTCTGC
CTGATCCTTTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAAGTGAGCTCTTCAAGTTGCCTACG
ACTTCCTCGGTCTCCGTAAGCTTCTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGTACGCAGCATATCCACGTACAGTC
GAATCAGCTCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCTTCAACACTGCGGTGAATTGTCAC
GGCCATGCGGCACAATGTGTCCACATGTGTGTCAATACCAAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCACTGAGTTAAGAGCGTCTTCTGGC
CATGCATTGAACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCCGATAGGAGAAAATGCCAATACCA
CATGCAAATTATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCCAATGGACGAACGAGACCCACAAT
TTTCTCCACTTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGGATTCATGAACGATTTGAGCATCC
GAAAACAGGAAAACGACAGGCTGGTTCTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTGGCGCCATATCCACGAGTAATTT
CGATCGAGAAACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAACGAGTAGAGCATTACCGCGAGG
CTGTCGCAAAACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACCAAGTGCATCTGACTCGGGAACGTGATGTTGTACTCTTCGAGA
TACTCTGACAGCAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCGCCATACAAAATATTCTCGAAGC
GCGCGGGAGGCCACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCGTCTACCAGACGATCACGGAA
AACTCGTGCTTCTTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACACCCTGGAATACTTTGGAAAGA
TCACGAAGATTGAACGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGAAGCGCTCACAATAGGTGCTG
CCATGTGTGTCATTGCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGATGAGAAGATCCGCTGCATAACCTCACCAGAGAGATTGGGGATCCAAAC
CATGTGGAAATGACGCATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCACATCCTTCACATTTTTAAAG
AACATTTTGGATGTGTCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATTTCGAGCGCCGGCATATTCA
AATCATCCACAAAGAATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGAACATCTCGTTTAGGTTGCG
AGGCTTGGTTTGCGCCGAGTAACTCATGGTAGATGCAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGACAATAACAGATTTGCCAACA
CCAGTCTCGCCACTATACAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGCGTGGGCACCACCATCGTGA
AATACGACGCTCCGGGGACAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGGCCAGTTGAATCATCTACTACCACTTCGTACACATTAGT
CACGGGTGTGCCGTCAGGACTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCGTCGTCGATGTTTGCTCCG
ACAGACCACGTAACAGCAAATACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGCTAGCGAGACAGGATGCCA
GGAGATTGAGACAGCTCTGCATCAGGTTAGCATTGTTGCTGGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGCCACAGGAACATGAGTCTC
AATCAACAAGAGAAGCATATCGCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGGTTCGCGCCAAGGATGTCAATCCTACG
TGCACTTGCTCCATATACACCATGCCACAACGGCTGACAGTAGCCGGCGAGGCTACACGGAGATCCTGTACCTCAAACATCATGTGAAGTGTGTGGGGCA
GTTTGATTCGCTCACTGTTCGATAAGCACAATGTCTTGTTGTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATCCACGGGTCCGTCAAAAAT
GACCCAGTTGCGGTTGTCAGACTCAGCGGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCGTTCGTTAGGAGATTGAAC
TCACCATACAGCTGTCCTGCGGAGATAGATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAACAACACCATCTTGGTAGA
GTTGAGTCAGCGCTCTCGCCAGCACGTATCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACGGACCAACTGCGTCTCGTG
AACCTGAATCGCCTTCGTGATAAATGATGGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGGCTTTCTGGAGTAGCCCATAGTCGACAAAA
GGCACCACAACGCCTGGGAAGAGGTCTGCAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTTAGGTACATTACTGTCTCGCATAGCTCGGA
TGAGAAGCAGATCCTCGTGCATTTCGGGTTCCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCATACCGAAATCGTAGTGATC
TTGCTTTGACAATTGCTCACTGGAGAGCGAGTAAAGCTGAGTCATCTTATGCGACAGCGGCAAAGCATTCGCAAACCCCTCCGAGAAAAGCACGATCTCG
GCAATTAAACGGTAGTCCGGCACCATCATAGCAACGGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCAGCATAACCCGGATTCATTG
TAATGAAAACGCCAAAACCTGTGTTGAGTCTAATGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCTGCTGAATGCAAAGTACCTG
CTGAGCAATCACAGACAAAACTTCGATATCAATGCGGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCCAGAGAAAAATCGTCCCATA
ATCTTGTAATCCAGTCCATCCGAGCAGTTGAAGACGACACACTGCACTGCAAGCGCTTTAGCCAAATCTTTCGTGGTTTCTGTTTTGCCTGTACCGGCTG
GTCCAGCAGGAGCGCCACCTAAACGTAGATGCAGTGCACCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCACAAGTCTCGGTGAATTGCC
AAGATATTCAT