Description :
From Genome Similarity Track
Location :
Scaffold_14:55200- 57114
Transcript NameFunction/comments
Physo_131010hypothetical protein

Sequence
1914 bases(100 bases per row)
ATTAATTTTAGACATTTAATAACGATGGTATTACCTTTGTGTATCATTTGTGTATCGTAATACTTAAATTTTGTCTTAAGCATCTTAACTTCTGGAAGAG
CAAGCTTTTGCTCATATCAGCTTCCCACACAATGCCAGCCTGCTGCGTTCTCCGGTCCCAGACTGGAATCTCTTCCCTAGATCTACGCGTCGCTCGGCAC
CAGCTCGTTGCTCGGCCAGGACGTGAACGGCGCCGACGCAACGCTGGCCACGGGGCTCCCAAAAATAGGCCCAAGGTGCTCTACGACGCGTACATCGCCC
CACATTCAAGCTGATCAGCAACGACTCCGCAACGCAGTAGTCAAACGCCCGCTGGATGTCATCAAGGAAGCCATCGTGTACCTGCACTTCTGCTTTTCGG
CCCGAGACGATGGACTGCGACAAGGCCACTCAGACTGCTTACAGAAGCTGTTTCGGCGGGTACGGCGCGATGCACTGAATATGTGAGCTAACTGATGTGA
AGCTCTATGATTATAAGAAGAGCAAGACGAGCTGGCGTTTGCAATATTTGAACTCGGATTAGTCAGGGCAAAAGCGGTTTAGCCCTCCACCTCTCTTTCA
CCCCTAGCACGTTCGCCACCACTAAGGTCACCAAAGTGTTCTGCGACCGCCATGGCCACAGGTCCACACGCAGTTTCACCACGCACAAGCACAGAAAGGT
TGTGTGCACGCTGAAACAGGGTGGTGAGGCCGGCAAGAGCAAATCGAACATCCTCGGCTACGTGCACGAATGATCAAGGCTCGAGTAGCGCGACGACGAA
TATGCCGTCACGTCCGACAAGCACCATCAAGTCTACCCCTATCATGAACAAGGTACATTCGCGGCAAAGACAATAATAGTGGTTTCCGAGGCGGGGGCAA
CCAACAGCCTGACCCCCCCCCCCCCGACAAGAACGGCCCCTCAGGCTCGGCAGTTCTCTTCTCTCCAAGTCCGACAAAGAGTGCTAAAAACCGACCACCT
CTTCTCCAACCGCTATGGCACGCCGCGCGTCCAAGTCGTCGCCTGCTCGCCCTCGCGCTATCGCAGCCAGCGCCGACACAGCTGGTGCCCCTGCTAGCTC
CGTAGGCGAATCCGCCCCTGAGACCTCTAGCGACTCTGCGGCAGCCGCGGCGGGGCCTTCGCCGTCTCAAGGGCAGCGTAGTCTGCCGTCAACCGGCCGT
GTGGTGCGCCGTACGCGGCAGTCGGAGCCCACGCGAGCCAGCAAACGTCTCCAGAAGCGCAACGCGAGCGACGCCCCAGTTCCCCCAGCTAGTCGCACGG
CATCGAGCGAAGGATCGTCGGTGGAGGTCGGCCCCACGGGTGATCCAGCGGACCTCGTCGTCGCTTCCCAGTCGTCTCCAGGAGCGAACGCAAAGGGGCA
AGAACCGGCACCGAGACGCCAGGCCCCAGGCAAGCGCAAAGTTCGGAAGACGGTCGACCATCAAACCGCTGCGCTGTCCATTCGGCGGGCGGTCACGCTG
GCGGCGGATCCACCATCAACGACCGAAGGTGATCAGGAGAACTATCCTGCAGATACCTCACCGTCTGTGTCCACCCAGCCTCGGGCTACGGAGGGCAGTA
CGAATCTAGTGTCGGTGAGCGAAGTCGTAGGCGGGCGTGCGTTAAACTGTGCGAGCAACCAGGAAGCGGTGGTAGATTTAACGACAACACAGCCCTCTCC
AACGAATTCGGCTATGCCCTCTCGCGGCGAGTCTACTGCGACCAGCGCCTCTGTGAGTAGGCTTGCTGAACATTCTTCGGCCCACGGGCACCAGATTCCA
TCTGGAACGTGGGGCGAACATGACGATCGCGTGGATTTCGACCTGGAAGAGTTTTTGGCCCGATATCAGCTCCCCCAGACGGCCCAATCGTCTGCCCAAC
CTGGAGGAACTTCG