Description :
From Genome Similarity Track
Location :
Scaffold_1567:552- 1944
Sequence
1392 bases(100 bases per row)
CCCGTAATGGTAGCACGTCCTGAGGCTACCAACATAAAGCGTAGGATACGCATGCATCCTACGTGGCATTTAATTGTAAATGATTCGCCTAGGCAGCTCG
GCACACGAAATGAGACGATGAACTTGAGTTATAATTTGTTTGTACTTACGTTAGTCGCTATGTTTCAAGGTAAGTTTACCAGTGATAGCATGACTATATA
GCATTCATTAAGTGAAGGAACATTTGCCCTCCCAATATTTTCAGCGAAACGCTTTTGTTGATCCACCGCTTCTAAGATGGAATTTTGTACAAAACGGACA
ACCGTTTCACGAGCCAGTATGAATTCATCTGACGACTCCCTGGCTTTAGCTGTAGTACACTGCGAGTGCACTGTAGAAATATTGGATGTTGCACCAGTGA
GCGCGTCTCTGGACTCATTGGGTATGATGATTAATTGATATGCATTCTGGTTATTAAGAGCATCATCGCTCTTACTTTTCTCTTCTTAACCGAAGTAGAT
GCGATAAAATTCAGCATCGTACGTAGTGACCTCACGGTCAGCACGTAATGAATGAGAGCCGAATTGGCGTTCGCTCGAAAGAATATCTCCCCCCTTGAAG
CTAGATTCACATTTTAATAAAGTGGGTAGACGCGGATGGCACAAGCCATTCACAGAGAATAGCGTATGCGCCGTCAACGCATGTACTGAGTTGCTGATGG
CGAATTTCACCATCAGCAGAAATTCGTTTCAAAGTGTAAAAGAATGGACATATCCTCGAAAGATCTCTGCGAGGTCAAAGTTGGCGCGTTTCGTATGATC
ATCTCTATCAGGTTAATCAGATGTAGACATCTTGGGGAGTGTTATGAGCGTTTGAACACGGAGCGCCAGAAATCAGCCAGGAAAAGTGAGTCCCGATGGG
AAACCATTCAAGGGCAGCTCATCAAGGCGAACGATTGCGTTGATGAAGATACGGGCATAACCCGAGGCTGTCATCGATATAGGTACAGCAACGAGGTTCG
ACATTTTGCTGAATCAATCTACGAACACAAGAATAACATTATTCTTATGTTTTCTTGGGGAACCCAAAGACCTAGTCCGTTTAAACAAACTCCAAGAATT
CTGTCATGACAGACAGAGGGTTAAAGGGTTACAGACGTGAAGGACCAATCTTCATTCGTCAACAGACTTCGCAAGCGCGAACTTACTTACTAGCGAAATA
TACTGGCCAGGACAAATAGAAGTCCAGACTGAACGTGATATATGTTTTCCTACGACCACCATGCCCACCAAAAGGTGCGTCCTGGCACTCAAACATGATC
CACAACCGCAGATCACCATAATTGAACATGACGACACGACGCATGTAGCCGGTAACATCGTAATAATACATTAGTCTAGTACACACGGTGTA