Description :
From Genome Similarity Track
Location :
Scaffold_26:55169- 57311
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009539Similar to UBE3C: Ubiquitin-protein ligase E3C (Homo sapiens)

Sequence
2142 bases(100 bases per row)
CCTCGCCACTCAAGCTCAGGAATCGTTAGAGCGTGGGAACTCGCTCATTTCTGAAATCGAGATTGATGAAGTAGTCGAGTTGACAGAAGCGACATTTATC
GACTTTCACCTAACGACTTGGGTGCATTTGCGAAACGCCGTCGACTTTCTGAAGCTGATGCACTCCGACAGTAACAGAAAGCGCATTCGATGTACTTCAT
GGGGGCTGAGCAACCTGGTGAAAGTGTTTTATCCCTATTTGGTGAATCTTCCGCGAGAAAAGCTGTCTGTGAGTTGGCGACGAATAGCGCACCTCTTTAA
TTCCGTGTCACCTGATCTTGACGGGCTTCTGTTCTTGATGGACCCCACTTGCAAAGCGCTGCTGCTCGCAGCCAGCTCACGTGGGTCTTTGCTAGAAGGA
GAAGATGAATCGGACGACGAAGATGGAGACGAGCGCACCACAAAGTCGTTTCCGAAACTAACCCTGGTGTGTCAGCGAGAAAACGTGCTCGAGACCAGCA
TGACCATGCTATGGTCTAAATTTTTTAACGCGAAAGAGTCATCACGGGTCCAGCATGTCGTGTATCCTTTTTTCCAATCTTCTTTTGGAGAGAAGGTTGT
GGACGGACTGAAAGTCGAAGAAGGAGAAGGCAAGGGCCCTCTGAAGGAATGGATCGTGCTGATCACACGCGAGATGACTGCAAAATGGAAGGATGTTCCC
ATCGACTCGTCGATTACCAACGGAAATGAATCTGCGGAAGCGAACGGGAACAAGCTGACTGCGCTTGGGTTGACACGGAATTTGCAAACTGGATTTGAGC
TATCGTGGTCATCGGACCAGGAAGAGGCCTTCAGTCGAGTTATCAACAAGATAGTGGACGCAGACACTATTCTGCTTGATAGAGGGGTGCCAACATATTC
GTTCTCAATCTCCGACCTGAAAGTTCGGCAGCCGAAACTGGCCTTCCTTGAGTATATCCAAGCATCGGAGAGCTTTTGGTTGAACAGTCAAACTCCAGAC
ACATTCGAGAATCGCCGGGTGCTTTACTTCTATGGATGGTACTTGGGGGTTGTCATCTCTCACTACAGCAAGATCGACCTTCCTTTTCATGAACTTTTCT
TCTCGTTCTTGTTGAATGAAGACTTCCAAGTTGCATTGGACGGCGTGCGGTCTCTAGATCCGTCTCTGTATGATTCGCTGATGCAGATGAAGCAGATGTC
TCCGTCTGACTTTGCAGCGTACTTGGACTTTGAAGGTATCAGCTCGAATGTCTCCGTCGATGACTACATCGTACAAGTCGTGGACGAAAAATTCGGGTCA
AAGTCAAGCATTCGGTGGCAATTTGATGAACTTCGCGCTGGTTTTCAACGAGTCTTTTCACTGGACGAGCTCAGGTCCGCGGATGTGGAGGCGAAGGATC
TGGCCAAAGTCATCTGCGGATCGCCAAGTGATCGCAAAGCTCAAGATTCGGATTTCAATCTCGATGAGATCTTCCGAGTGGCGTTAGATCCCGACTTCGT
GAAGTGTTTGCCTCTACGTCGAGTGTTTTGGCGAGTCGTGAATGCGTTTGGCCCTCGACTGAAACGAAAGCTGGTCAAATTTATCACAGGTGTGGATACG
CTGCCGCTCCCGGGGACAGAGGTAAGATATACGCTTTTGTTAATGATGTACCCATGATTCTGATTTCATTGCAACTTTGTGTATGTGTAGTTCCTTCGCA
TCGAAATGCCATTTGCAACGTTGACGGCAGCAGAGAACGAAAAGGTTTTGCTCATGCTCCCGCAATCACATGTAAGACACTATATGATTGTACTAGCATG
ACATAATTATTGATAATGGTGCTCACTCATTATCACCCAACAACACATGCCATTTGCACTAGACTTGTGACAATACTCTCGAGCTCCCGCATTACTGGCG
AGCACTTTGCTGGAAGAAACATCGCGATGAACATCTAGGAAGCGAGGAGCTGGAAGACGAGTTGGCTGCTCTATTGACAAAGAAACTGGAGGATGCAGTT
GAGTATTCGAGTGGATACGGTCTCGACGGAACGAGCACTGTTTCGGGCATTTTTCCAGAGAAATCAGGGAAGCAACCAGGAAACGCGACGAGCAGGAGTG
ACTTGGTCAAAGAAGAAAGCTACGAGTCACTGGATCTCCCAG