Description :
From Genome Similarity Track
Location :
Scaffold_3:551682- 554096
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01339RNA 3'-terminal phosphate cyclase
Phypa_INRA-310PPTG_01340hypothetical protein

Sequence
2414 bases(100 bases per row)
TGAAAAACCAGGAAATTGAAGGATCTGTTGTATTAAACGGTGGAGATGGAGAAGGTGGAGGGCAGTTGCTCCGTGTCGCGACGGCTTTAGCTGCTGTGAC
GCAACGTATTGTTCGTGTGCATTCCATCCGTGCGAACCGAAAGGCTCCCGGTTTAAGGAACCAACATTTGAGTACGATTGAGCTGGTGGCTGCTTTGTCA
GCTGGTGGAAAACTGTCAGGTGCGCGGTTAAACTCAACAGATCTCACATTCGATGCACGATCAGCGCTATTGACTGGTGCTAAAGGAGGGGCCTTTAGTG
CCGCCTCACGTACCGGTGGCAGTATCTCTTTGATGCTTCAAGGTGCATTCCCAGTATTGACTTTCCGCGACAGCTCGACGGAATTAAGCTTACGTGGTGG
TACACACGTTGGCTTTAGCCCGACGATAGACTTCATGCAGGTTCCTCTTCGTTCCCTCCTTGCACGTTTTGGTCTCAACTACAATTTAGAAGTATCCAAG
CGCATGTTCTTTCCTGGAGGTGGTCCCAGTGGTCAAGTGCAGGTCTCTGTGAACCCTGTCGATGCTGAGAAGACGCTGCAATCGATCGATTTTACCGAGT
CTTCTACATCTATTCGCCATGTATTCATTCGAGTGACAGCATGTGGCTCCTCGGCGAACGAAAAGATGGCAGAGCATTACGCGAGTGCGTTGAAACTAGC
CATTACCCAGACATTCACTAGACTGAGTGAAGATCTTGAGTTGGAAGTGGAATGTATCGTGGAGACCACAGCAGCTACAAACCAGAAGAAGAAGGCTTCT
AAAGTCCTTAAAGCAAAGGAGAAAACTGCTGTCTCTTCCCTTGTCGTGCTGGAGACTGCAACCAACGGGATCATTTCACTCGACCGTACGGTTAACGTGA
ATGAGTCTACCGCCAGTATTCTTGCCGATCAGATGAGTTCGAAGCTCAGCGAGTACGTCCAGAGTGGCACATGTGTTGATGAACATCTCGCTGATAACGC
CGTGGTGTTCATGGCGTTGGCACAAGGTACTTCTCGTTTACGTGTACCATGCAAGGCACAACGTACATCACAGCACTTAGAGACGGCGTTGGAAATTGCA
AGTCGTCTTACGGGTGCTGCATATCGACTCTTGGAGGAAGAGACCTCAGCTATTATCGAAGTTGACGGTGTTGGTCGTCGCCAATGCGTTTCAAGACCAT
AGTGAGGCGCCGCTTTGTTAAGTCGTCTCGTTAAAGCAGAACCCCAATGAAAGAAGGTCCAGAGGAGTTAGCTGTGAGCTCTCGTCGCAAGAGCGATGCA
TTGGCTAGTCGAGCGAGTCGAGTGAGTCTACAGTGGTCGGTGCCTTCGTTGGAAGGTAAACCGCCGAGCGCTCGGGGTGGCCACTCAGCGGTGTTAGCAG
GGACTCACCTGTTAATCTTTGGAGGTCACTACTTCGGTAGTGCAGGCGGGTTTGTGTACCTGAACGATTTGCATCGCCTAGATCTTGGAACTTCGTCTTG
GGCTGAGGTGGTCTTCCCAAAGGAACAACCACGTCGAGAGCGGGTTGATGAAGGTGAAGCTGATGCAGTTGTGCTACCAGCTCCACGATACGGTCACTCA
GCAATACTGTTGAACGATAACGAGCGTATGTTCGTCTTCGGAGGTCGCGGTGCACAAGGCGAAGCCTTTCGAGACATGTTCTTCTTCGATCTGAACGCCA
TGGCTTGGCAACAAGTGCAGTGGACCACGGACTGTCCTGCTGGTCGCTATGGTCACGCAGTCGCGTCGGTAGATGACGAGAAAATGTTCGTCTTCGGTGG
TTGGGACGGCAAGAAGAGCATGAATGATCTCTGGGTCTTCGACTCGACCACCTTCACTTGGCGTCGACCGAAATGTGCGGGTAAACCACCCACTGCACGC
CAAAATCTGTCGATGGTAGGGCTCTCCAACAACGAAGACAGTCCGCCATCTCTCCTCCTGTACGGCGGATACACTGTGATACCCGATACACTGCCAGTGT
ACAACAAGGACGTGTACGTCTTCGACGTTGCAGCGATGGCCTGGAGTCGTCCCAGACTTGTCGGTGAGTACCCACCCGGCACATTCGGCCAGTCATTGAA
CCTTGCAGGCGCTGGCAGTGGAGCTGAGCTAGCAGTGATGCTTGGTGGCTGGTCCGGTACTGAGCGTACGCCGCTGTACATGGGAGACAAGCAACTTCGC
GAGCTTGTTCGACAAGAGAGTCGAGAGCAACGTCTCGTCAGTAGCAACAACCAACGTGAACAGAAGCGGAAGAAGCGTGAACGGAAGAAACAACACGAAC
GAGACCTTCGTACCACCTCCTCGTACGCGCGAGTACTGGACGTGCAGAACATGGAGTGGCATCGTGTGACTGCGTATGGCGTAGCTGTGGCAAACCGCTA
CGGCCACACATCGA