Description :
From Genome Similarity Track
Location :
Scaffold_120:5516- 15893
Sequence
10377 bases(100 bases per row)
AACAGAGTTCAATTTACTTCAAAAGACACACGCTATCTATTCTGAGCAGGAGCTTTGGCCTCCCGAAGAATAAAAAGTCGAGCTACACGTCTACGCAAGT
GTCGCACCTGGATTGTTTGGCCGGGTGGGTTCAAGAACTCTCAAGACACCAAGTCGACTGCGATCGGACGCAGCAAACACAGCAAGGGCAAGGGGTGCAA
GATCTCGAGACGGCTCAAGTGGTCAGAAGGCTCGCAGGATCAAGCATTACCGTAAGGTAAGGCGATCTGTACCAGATCAGGGCAACTCATACAGAGACCC
ACCCAAAACCAACGCGGTCGTGTGAAGTTTTCCACGCGATCGACACCAATCTCAACCACGGTCAAGTTTGACATCGAATCGAGTCCATCTGGAAGAGTGC
AACCCGCTCTACCGACGGGTACAAAAGGTGAGTAAGGCAAAGCACACGGAATCGGAGTACCCCCTCCGTTAGTCGGTCGTCTGGGTGCCAGTGGAGAGTT
GGGACCGCCTCATAAAATGAGTGAATCTTAATCAAGACTGAACCTGGGATTGAAGCGTCAGCGAAATAGAGATCGTCTCGTACGTGTGAAGATAAAGGAT
CTCCATATCAACAAAGTTTTGGGAGGGACTATGATGACAAGAAAACATAAGAGGAAGATCGATCTAGAAGAAAAACCCCAACCCCCTCCTGAGGTCCCTT
CGGGGACCACCGCGAATCATGCTTTGCAGCATGATTTGCTGGGTGAAAACCCTTGGATAAAACTGAACAAATTCAATCCAGGATAACGCCTTCGACGTCA
AAAAAGAAGAAGTTGAAGACTGCACGAGTGAAGAAGACAGCGCCAGGATCGGATCACCCCAATCGCGTGACGAGATCGGCCATCAGAACAATCAAGTTTG
TGGAAGATGAGGGTAAGATGGAATGCTGGCAACTGGACCAGATGGCGGAGATGTATCACTGGAAGACGCTCAAGCAGTGCTTGTAGAACGATTTAGTACA
CCGGATACTGAAGCCCAAGATGATTGGAACAATTTAAGGTCCTATATCAATCCCAGCTATCGTGTCGAATACACTGGATGGAATCAATGGGATTATACAG
CTGCTGAACGAAGCGGTATTCGTCGCTGGAAGTTCGACGCAAGAGAGCTGTTAGATTGCGAACAGGATTGCGTGATACACGCGTGTCAATAGCTGTACGA
GAAGTAGTCTCTTTGACGGGCATACGTAAAGCTGACGATCACGCGGAAGCTACTGCGGCGAACCATCACGTGGGACTGACGTCTGCAGAAGTTCCGAGAG
GATATCACACTAAATCGTCCCAGTATGCCTCAGCCGAGCCTGAAGTCGAGTCAGGGGACTCTATCGGCATTCAGCGGATGTCACTAAGCCCAAGTGGGGC
TGCTTATCTGCGTGATCGCATGGAAAAGAAGGCCAATCTGCGTGATTGCGGGGGAAAGGACCGAGAGTGGACCGCAATCGGCACATGTACGCGCTAAAAA
AGATACGGGTACGAATATATAAGGACAGCTTCAATCATATTTTGATGCTGCTATGGAAGGTTTCAGTAGTAACGAAGTAGCCAAGCCTGCCAAGCGATAT
ACACAAGTCAGAGGATCAAGGTTTTAAGAGACCACGAGACATACACCCCTAATATCGAGATGTAATCGGTCGGATCGCATCACGGTAGAGCTGACGTTTA
ATACCGTGAAGAGGGAGATCCTGAAGATTCGGGGCATGACGAGTTGAGACTCGTGGATTCTGCGGAGACAGCGCCAAGTGGTGGACTTAGCACCTCGCGG
ATTCAGATGTCTGTGATCGTGGAACTGAAAGAGTTCAATGGGGACGACAAAGACGAATATCGAGCCAGGAGATGGATCGGCAAGGTCAAGTCGCGTTCTT
ACGTGATTAAGCCCCAGATGTGGAGAGGTTCTTCATATTTGTAGATCTGCTTACGGGTCCTGCGGGAAATTGGCACATCCAGCTGAGCCGATCCACTCGT
CATTTGTGGAAGGAACTGTCAAAACGTTTTCTCGTGCAATATGGAATGAATGGTATGTTTGTTGGAAGACAATATTACCTTGTCAAGAACCGACCGGACG
GAACACCTCTAGATTACCTATATCGTTTGAATGTGGCAGAGAATAGAACAAATATACGAATTCGAGATGGATCCCCAGACATACGTCGTGAACATGTGGG
AAGTTTTATTGGGACCCTGGACGATCTCGGTCTGGCCAAAAAATTGATGCTGTTACGGATCGGGGGTGCGGATGATATGGAGGAGACATTATGCGCATAT
TAGCGCATGGAGGATCGAGAAGCTCAGTCATTCTTGGGATCGAATAAATTTCGACCACGATCCGCACCCATGGCTTCTACAACACCAGCGAAACCAGCAC
GTGCTGTGAGGTTCATTCACGTGGAGGGTACAGACGGTGATTCGGAATCCGACCTTAGCGGATCGGACACGGAACGTGAACCACGTAATATTTTTGTGGC
CGCGACCTCGGATCGCCCGACGAAGTTTGGATATCAACAGGCTAAGGCCGATGAGAATCGTCAAGACCACAGTTCGGGTCGCGTCGCGTTTAAGAAATCC
TGCACTCATTGTGGATCGAAGAGACACGACGATCGTGGATGCTGGCAGAGACTGACGTGCCAGAAATGCGGTCGCATGGGACATTCATCGGACAAGTGTT
TCTATGTTTGTGTAGCTTGTGGAGAGTTGCGTGAAAATAGCAAGTTCCCCATGGAAGAGTTTTAAACCTTGATCCGCAAGTGGTACGTGCCTACCGAACA
TGCTGGGATGTTTCCTCCGAAGGTCGAGGAGATGTTAAACTAGGACGCTCGCCAGGTTGGAATCTGGCATGAGCCGAGCGTTCAAGCTATGCATATATGA
ATTCGTTATAAAACGGTTGGAGGGTCAAGGAATTAAGGACCGGCGCGATCCGATCGCAAATATATGTGATTGTTTCTTCCATATCAGGTGTGAAACGAGT
GAACAATTGTGCCCGATCCCTTGTGAAGATGAAGCTCGAGCTAGCCCTAGGGGAATCACTCGGATACTGGAAGTATCACACTTTGGGAGAATGATTCAAG
CAAGCAAAACAGTGGGCAAGATCAGTAATGAGAGGGCCACTATGCTGTTTGACTCCGGTGCAGAGATCTCGAGTAGTATCGACACAATTTTTGCTCTTTA
GGAAGGATGTGCGATCGATGAGAGCTGAACGCAGGAATGTGTTGGTATCGGGGAGAGTGCTTATATGACGATGGGGCGGATCAATATCAAAATCACATTG
GACAGATCGCTAGTATGCTATTCTGATGTTTGGGTTAGGGACCCAGTTGGCCAAGAAGCCATACTAGGTATGGACTTCATGGTTCCGGCAGGCATCCGTT
TGGATTTAGCCAATGGAACCCTGTGTCTACCAGAAGAACTTAATATTTGTTTGGCTGGACGGAGGCTGCCGTACCGATCAAATATATCGGCGATCAACCT
TAGTTATCATATTGTTATCCCTGCCGACAGATCTACTGAAGTCTAGATTGGCGTCAATCCTTTCAAGTCCAAACTTTGGGTGAGGCGAGATGTGGCGTGG
TTCCTACAGTGACGAATGGTCCTGGAAAGGTTAAGTTCCTGCAGCTTTCGAAAATAGACGATCGCGACTTGAGTTTAAATTCCGGGGATCCGCTAGCGCT
TTGGATGACAGTGGACATGATACCGCGATCGCAAGGACATGTGTATGACGGGTCACGGCGGTATAAGGAATGAAAAACATTGGCATTTGAAGCTACTGTA
GATCGAGAAGAAGGAGAGATTGAAGCATATGCGGGACCGCTGGTGGATTATTCAGCGTACGAGAAACCCACCCGATTTTTAATCCGACCAAAGAAGGAAA
TGAATGCGTCAAGGTTTCTGCAGGGATCGCATCGAGATCCAAACCTGATTGTAACACTGATGAGGAGATTCCAGACGAGTATACCGGAGCGAAGATTAAC
GGAAGCAAGGATCGGAGATCGACAAAGGAACTGTATGCGGTCAACGCAGTGTGAGGATCCCAGAACGATCAAGTGAAGTGATCGGAGTTGCAAAGGTGGC
TGTAACACAGGAGGTCGCTCATTGATCACTAATCCGCTACAGAGACGGTCCAGCTATCAGCTAGACGGGGTCAAGGTTGAAGCTCGGGAAGTACATGGTC
GGTCCACAGGATTGATCGATAGCGCGGAGGCTGCTGCGATTGACGAGGAAATAATGAAAGAATATATAACGGCTGAATCCATATATTAACACGACGGTGG
CGAACGGTTTGCGGAGATGTGGAGCATCATATGGCTGTACTACCGGAGGCAAAGACATCGTTGACGGAGATAACGATCGACGATATTAAGGTTGGCGGTC
CTGGGATATCCTTATCAAAAGATCAAGAGGATTTGCGACAAATGATATGGAAGATTCGTCACCTGTTGATTGTAAAAGGAAATGCGTTACCCCCTGAAGC
ATGCGGGGCCGTGTGCGATATTGATGTTGAAGAGGCAAGACAGAACTCGCAGCGTGCGCGACCGGTGTACCAAAATTTCGTGAAAAGTTGGCTGATCTGA
TATAAGGCGTGTTGTAGGCTAAGATTATTCGTCCTTCGACATCGCCGTGGGCGTCACCAATAGTCGTGATCATTAAGGAGAATGGGGAAATTATTGGACT
ATGAATCGACTATCGAAAAAGTGAATCAGCTAGCACGTTGATGGTTATCCCATGCCGCTCATTAGCGGATTGTTGCAAGATATGGACAAACAATGTAGTA
TTGTTCGCTGGATATGGCTTAGTGGATTTTGGGTGGTGAAGATGGCCGAACGAGCAAAGTTGATCTCTGCGTTTATCACACCGTCGGGTAAGTTTGAATG
GTTGAGGATGCCTTTTGGACTGAAGAACGCTCCACAGATTTACCAGCGCTTGATTGATACCACTTTGTATGGATATCTCAAGATAGGCGCGGGTAAAGAT
GCGATTGCAACGGATCCCCCTAAGTTGAGTGATGTGTTCACTGAGGGACAACCCAAAACCGACAGGACGCCGACAGTGCTGGGCAGACGATCTTATATTG
ATCCCAGTTACATCGTGGACTTTTCTGTCTAACAAGGTAGAGCGATTACGGACAGTATTCGATCGATGGAATTTGTAGGTCCGCCTGACTAAGCGTTTCT
GGGGACGGTGTAAGGTGTATTACTTGGATCACCAGGTATCATTGGATAGGTTGGAAGCTAGTCCTAAGGATCTAGGATCGCTGGTGAATGTACTCTTCCC
CACGACGTTGCGCGCCATGCATTCGTTCCTGGGTAGTTTAAATTACTCCAGCCGCTTCATGGTGGATTTTTTTGCAGTATACGCACCTGTTTTATGCCAG
CTACGAGAGACAGATTTTTACGAGATTTACTGTATGGGTGATCGTGATACGATAGTAGGAGATCTCTATCGTACTCCAATTAAGGTAAGGGATCACGAGC
TCACCCTCCGAGAAGATGATCGCGACCTGAATGGGCGAACTTGGTGGGAAGAAGCTAAAATCGCATTAGCTATACTGAGAGCCAAGATCTCAACTACTCC
GACCCTCAGGTACTTTGACCCAGATCGACTCCCGGTGATCGTGGTATATGCTATCAGGAGCAGTGTCTGCATCCTGCTGCAGGATATGATGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN