Description :
From Genome Similarity Track
Location :
Scaffold_49:5515- 12099
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_49-snap-gene-0.32Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_49-snap-gene-0.18Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_49-snap-gene-0.33Guanine deaminase
Pytap_DAOMBR444maker-pag1_scaffold_49-fgenesh-gene-0.7Exosome complex exonuclease RRP44

Sequence
6584 bases(100 bases per row)
CCGCGGCTTCTACTGCGGCTTTTTTCGCGGTGATTTCGCGACGCGTTGTAGCTTGGGCTGCGGCTGCGTCGTGTGCTCTTGTGGACGTCGCTCGGTCTCG
CGTTCGTCCTCTCACCGTCGCGCTTCATCACGTGCAACCCGCCTACGCGCTCCATTGTTtCCCCTGCTCGAGATGACCGACAGTGCTCATGTACAGGAGG
GgAAACCCCACGCATCTCTCTGTATAAGAGACTACAATATACGCTAACTGACTGGACAAAaTAACGTTCATTCCGCGAAAATAACTGTATTGCCCAACCG
CACATCATGGCGGCCACCGGCATGGACATGGACGCGGAGCGCCATGACACGACGCCTCTGGACGTCGAGAGCGCGCTCTTTGGAGCCATGGCTGCGATCC
ACATGAAGCACGTGGTGCCGACGGCCTCGCCACTCGACCACGACGCGTCGGGGCTTATTATCGCCGACACTACGACGTCGTCGGCATTCGACGACGCCAT
CGCCTCCGTCCATCCGCCACCACCACGGACGCCTGGCACACGCGGACGACCACGCATGCACGGCACGGGCCGCAAGCAGAATCGGTCGCTGCGTGAGTCT
GTGACGTACGCACACAAGCTGCAGGTGATCAACTTTTACGACGCGCACGAGCGCGACATCAACGCGACCATCCGCGAGTTCTACGCGCACTTGAATGCGG
CCCAAGTGTCGTCGCGCAAGCGGCAGATCTACAAGTGGGTCAAAGAGCGTGCGCAGATCGAGGAGATGTGCTTCAAGCAGTCCACTGCGGGCCACAGCCG
GCGGCGTGAGAGAGGCACAGCCACGACGCTCGGGGCCgAGGGGGAGCAGGAGCTCGTGACGTGGATCCGCGCCATGCAGCgTGGGGGGCCACAGGTAGGT
TTGACGCGCGtCTCGAGCCAGATAATCAAGGCCAAGGCACTGGAGATCGCGGCCAAGCATGGCGTGCCACCGGGCAGCTTCCAGGCGACGTGGTCGTGGC
AGCAAGGCTTTCTCAAGCGACATCAAGACGCCATCAACAGGTTCTGAGGCGTTGTTGTAATACTAGAGTACCTCCTATTGTGTCAGGAACTCGTCCTTGA
GTGTCCACTTGCGGCCGCGGCACACGGCCATATCGCGCAGTAGGTTCCGGAACACGAGCTTGTCCTTGGGAGCTACGACCGAGCCGAACGCATCCAGCAG
TTCCTCAGTTGTCACTCCTGGTGGTCCATGGCGTGTGCCTGTCGACCGTGACTGCAGAAATGCGTGTAGTTGCTTGGCCATTTCGTCTACCTTCATGAAC
CCAGAGACGGATAACTGCGGCGCCGAGGGAGTGGCGACTACACTACCCGACGAGATGCCGTTCTTGCGATTCTTGATGCGTGTCAACATCTCACGTGACG
AAGCACTGGACTGAGCAAATGGGTTACTAGACGAACGGGACGAATGCTGGCTAGCTGCTCcACCTCGACCACTGTtCACCACAACACCAGCACCcGGACG
ACCTCTTGCAACTCGGTTTCCAAATCGACCCCCACCGAGACCTCCTGGTCCACGTCCACGTCCACCATTTGACCGTTGATTTGGgTcGCCAGCAGTTCCA
CTTCGGCCTGTCCAAgTTGGAGTGAaCAGAGTCGCTCGTtGCTGTCGGACTAATGCACACGAagCACGCaGAGCACTCAGTGCCGATTGTGCAATTTTTt
GAGGACtCGAGTtCGATCAGGTCTGCctCTtGGTtCTGGACACCATCAGACTCGACCACGTCGTGATTGAAGACGCCCTTGATCTGGTCCCCACTGAATA
GTTGCTTGAGGATCGCGTCGTTATCCCCACCACCCTCAGCTTTGGAGTCTCGTTCTTCGTCATCTTCAGCTGAGTCTACACTTTTctCCTCTCCTTCTTC
TCCTTCCTCCCCTTCCTCCAGCTCATCACCATGCGATGGCGCGCCTGGGTTCGCAACATTtCCTTCGATGAACAGCTCCGTCGTTTCATTCCCACCACCG
TCTGCGGAAGCcTTCTGAGCTCCCAAAaCAAaCAAGTCTCGGAGCGTGTGCTTGTTGAAGCAACGTTTGCGCTTGGCGTCGTGAAGAACTTTCGTTGTCA
AATACTGTTTGAAGATCTGTCGATGATAAATTTTCTCCTCGATCGTGCCACTGGTGATTAATCTGTAGATTGTCACTTGCTTCGTTTGTCCAAGTCGCCA
TGAGCGCTCACGTGCTTGGAGATCGGTTGATGGGTTCCAGTCTGGGTCAAAAACCACGACACGGTCAGCACCAGTAAGGTTGACACCGATTCCACCAGCT
CGTGTGGTGAGCAGAAAGATAAAGATCTGACTACCGTCTTGGTTGAATGCATCAAGCAACGACTGGCGTTCCTTCACACTTGTTGTGCCATCTAAACGAC
AGTACAAATACCCTTCGCTGGCCATGAAGCTTTCCAAAATATCCAGCATTTTTCGAGTTTGAGTGAACAGCAAGACACGATGCCCTTGTTGCTTCCACAG
TCCAAGTATTTTCTGAAGCACCATCATTTTGCCACTTCCATCCACACTGCCATACGGAATCCCGGCAGGTCTTCGCGCCAGTTGTTGCAGATCAGCTCCC
GGTCCACCTTCTCCACGGTTGTTGTACTCACCCACAGTTGACAGCAAGTCTGGGTGGTTACATATGTGTCGTAGTATTGAGATGGCGCGAAAAGGCCGAA
TATCTTGCCTCAGCACTGCTGCGACCTCCGGGGATGCTAAGAaCATCTCGTATGCTTCATACTGTCGCGTAGTAAGATTGCAAAAGATGATTTGCTCCAT
CTTCTCCGGCATCTTCGTGACATGCTGAACCTCTTTCTTtGTTCGACGTAGCATATATGGATTGATGATATCCTTGAGTGCGAGAGCACACTTGTAGGCC
ATGACGACCTGCATTTTCGATGCATTGGCGTACCcGCCCGTGCGGATGGGCAGCACAAACTCATCCTCGAAaGTCGGCAAAGTCCCTAGTTTGCCGGGGT
AGACAAAATCAAACAATGACCACAACTCTTTGAGCCGATTTTGGATCGGAGTGCCGGTGAGGATAATGCGGTGAACGGTTTTGAGCTGCTTGCACACAAG
CGTGATCTCGGCATCTGGGTTGCGAATGCGATGTCCCTCATCAAGTACGACATAGTCCCATTCGAGGTCAATGAAGAGCTCTTGATATTGCCGTACGTTC
TCGTACGTCGATATAACAACGCCCCCACcGCGTGTGTCTCTCCTTCGACTTCTCACATTATCATGATCTTCCTCCTCAGCTGGTgAGAACTGCATCACTT
CATCGATCAACTCAGCGTATGAACGACcAGCTTTTGtcACCCCGGTTCCcGACGCGTGCAAGAGAacAACCCTTAACCATGGATACCACTTGTGAAACTC
TCGAACCCACTGAAGGAGAACACTTGCGGGGCATAATAGCAAGACTGTCCGGaCTCTTCTGACATCATACATCGCCCCCAAGAATGACGCGATCTGTACA
GTCTTCCCGAGCCCCATCTCATCACCAAGAATGCCGCCCGTGTTTCGTTCATGGAGGTGGTGCAGCCACTCGAGACATTCCTTCTGgTgCGGGAAcAAGT
GTGCGTACATGTATGTGGGCACACTAAGTCCCGAATCAGTCACCATGACATCGTGGGGgCgATAATAAaGCGGCTTCTCAGTCTTCTCACGTTCCCTtAG
TCCACACACCTGGCCATCATCATTGAATCCGCCATCATCATCGTCCATCTCGTCCTCCTCCTCGTCGTCTTCTGCATCGCCTCTTGGATTATTGTAGAAC
GTCAGCTCGTCATCGCGGAGACTCCGATCAATCCCTATGACCAACTCCTTGATCCGTGTCTCATAGGTCGCCACGCATCCGTCGTCTACCCAATTCTGTT
GGCTACGTCCGCGTTTATCACTCTTGAACCTGTGCACCTCGGGACTCGCTGCTCCCTCCTCCGCCTCCGCCACCTCCTTTTCCGTCTTCCTAGTCACTTG
ACGCTTCGGACTGCCCTCTTTAGCCTGCCGCAACCTTCGCTTCTTCTTGTTCCCCCGCACCGTCTTCTCCCCTGGTAGGAAGTCCGAGTCTTCATCCTCT
TCTTCCACTGCCACCCTCCGCTTAGGTCTTCGCTCACCCACTTCCTCGTCTTCTTTCTCCTCATCCACAGCGAACCCGAAAGCCACAAGCGCCGCGGCAC
TCTGCGGAGACGGTGGCGGAGTCGCTCCATCCTCCTCCACGTACGCTGGCGGCTCCTCGCCGCGAAGCAGCGCCTCTGTCGCGCGCGTCTCGCTCCGGAG
CCCTCCGCGTGCTGCCATTATCGGAATTCCACTTGTTTCCCTTCTTGGTCGTCGAGGCAAGAACTGATTTAAGGGAATTGAAGCATCCAGACAACAAGGG
AGTGATGGTCCATGAGTGCCATTTTCGCGCCACTACAGCCAGAACCGGACGGACGTGGGCGGGTTGGACCCCAAGATGGATCTCCATGGATAATGGACAC
TGGATCCATTTCATCGCTCCTTCAGTGAAAAATACCAATAATTTATTGCGTGGGATTACTCAAGCTGACTTGAGGGCAGTGAGTCCTCCcGCTGGCTGCT
TGACAACCTTACCACCCACAAAAATGGACTCGATGTTACGGTCATCACCAAGGAAGAGGAACTTCTGGAACGCATGCATGACATCGTGAGCATCCGTGGC
GTCGTGTGGAGTGTCCAGTGGACTATTCTCTGCATATGGGTCCACCACGAGGGCATCGAAcTGCTTGCCTTGATCGAAGTTGCCCACTGTGTCACCAAGA
CCAAGCGCTTCAGCACCACCCaCAGTCGCCAGATGGAAGGCCTCGGCAAATGTGAGAGCGTCgTGGGCCTTGTTCACATTCTCCTTGGCGCTACTAAGGC
CGATTGAGACCATCTTGGATGCAaTAACTGCCTGACGAATCGCGTCGAGCATGGATGGCGAGTAGCCACCCGAGACATCCGTGCCTAGGCCGACCTTGTG
GCCTTCCTTGAGAAGACGGCGCACGTTCAGTACACCGCTGCTCAGGGAGAAGTTGCTGTTAGGACAGTGAATGATGCCAGTGCCACGTGTGCACAACAGC
TCACGCTCGTTTGGCGAGCACCAAATACAGTGTGCCATATAGGAGCGATCATGCAGTAGCCCATGGTGGTCGTACACGTCGGCGTAGCTGTCACACTCAG
GATGCATGCTCTTGACCCATTCGATCTCGGCTGGGTTCTCCGACAAGTGCGACTGCACAGGCAGCTTTGGCTCGTGCTCGCGAGAGATGTCACTAAGCGC
GCGCATGAGCGGGGATGACGTGCTGGGCACAAATCGCGGCGTGATCACAGGCGTCAAAAGTGGATTCTTCTTCTCTAGAACATAGTCGACGAACTCGCGC
GTGTGCTTGATCGAATCTTCCGTAGTCTCGGTGAGTTCGGGCGTAGCGTTGCGATCCATGTTAACCTTGCCGACGTAGCCACGCTGGCCCAGTTCAGCAA
TGATGTCTGCAAGGGCCTTGCACGCATCAAGGTGGATCGTCGCAAAGTACGAGCACGTGGTAGTGCCATTGAACAAGTGGCGCTTGACAGCCTTCGTGTA
AACGGCTTTGGCGTAcTCAGTGTCAGCGAATCGTGACTCGTACGGGAACGTGTACGTCTGGAGCCAATCAAGTAGAGGTAAATGCATGCCGACCCCGATG
AAAGAGTACTGTGGAGCGTGCGCGTGGCCATCAACAAAGCCCGGCATAAGCAGGCGGTCGCCCAGGTCCACGAGCTCATCGTACCGGGCTTCGCTGAGAG
GGGAcTTCTGAAGGTCGAGTACATACGCGATGTGGCCACGTCCATCGACACCAACGAGGCCGGGCTGCAGCACTTCGAGCTTGTTCAGTCCCAGGGAGTG
AATTATGTTGGCCTTGTATGCCGTGATGCGGGCGGCGACGCAGCACATGGTGGAGAAGACGGGGGAGgAAGCAGGTCGAGTGGCCGAGTGGCAGCGCCGC
GGAGAATTGGCAAATGACTCGGCCAGGCCGCGAGGCGCGTGCGTGGCCATGGAGCGCGGAGGAGGACGAGCAGGCCCTTCAAGGAGACGCATGTGCATGC
ATGCAGCTCATTCACATGCAGAGGGCGAACACGAGGAGCTACACAACCGACTCGCATTCAGAGGGAGGTGTGGCCCAATGGGATCGCTATGTTCATCAAG
ACGAACGATCTGATTGGCTAATCGGAAAGGTTCAACTCGCATTCAGCCGCTCATTGGCCATCTGGACCGTTTTCTTCTTGCGACGTATTTTTCGAAGGAT
TGGAGACGATGGCAAACCGCCGGATTGGCGGCTTCGGATTTAAGAGAAACATTGAAATGACGGGGTCCACACAACTGAAGGGAGATGATTGTGTAAAATC
ATGATTATCTATAAAAACGTGTTTTACGCCTTGCTCTTTTTGGTCTTCTTGGCACTGCCATTCTCAGCCTTGCGCTTGCCGACCTGAGCCACTTCCTCGG
TTAGCAACTCAATCTTCAGCTCCTGACGGTTGCCGAACGTCGTGGCGACGAACACCTTGACTCGCACCGGGTCGAATACCTTCA