Description :
From Genome Similarity Track
Location :
Scaffold_139:55148- 56210
Sequence
1062 bases(100 bases per row)
CGCTGGACTCACAAATAAGATCGGGCCTCGAGCTTTTACGTACTTGCAGAAGACTGCCAACGAGCTTTCATTCCCTACTTCGTTTCCGACGAGACAACAT
GGCACCATCGCTGTGCGTGACTGTCTGCACGACACTCAGGTCTGCCGTCTCCTCGTTCCAGCTACGTATAGCAACAGCCTTTTGCTCTTGTCGGTATGTC
ACGCGCGCGTTCTTTCTCAGCTTACTCCTGCATTGAACTCTCACACTCCCGTGTCGCTCGTGTTTCACTTAAGGTTCTCGACTCCTACTGTGCCCACGGA
GGATGAAGAAGGAGACGCCTCTGACAGTGACGATGAGTGGGGCATCGTACACGCCCCAAAAATTCCCTCAGCTCGTCCTCGACCGAGTCGTATCCGACTG
AGAACAACGTCTCATGGCATCAGAGTATCTCTCGTTCTATCCGTTGCTGGCTGCCACCGGGCACCCTCCCGCCTTCGACTCCAGCGGTCTCAAGCGACAT
GGACGTTCCATGACTCAATACGGTGTCCACACATCGCACTTCGGTTTGTTCAAGACCCCGCGTTCACCATTGGTTTCGTGCTGCTGTCTCAGTTTGATGC
TTACGTGACAGACCGCTTGGAGTGTGCCACTCGACGCCATGCTGAGTGGACGAAGGGCAGTGCACTTTGTTGGTGTCCGCGTCTTACTACAGCGGTAAAC
GTCAATGGAACGGAGATTGCGACCGTGCCGCAACGAGCCTGCACCGACAAACCCGCTTCGGAAGCTGCCCAACAAAATTCGGTGCACCTATCGGCGGGAA
CAATTGCGAAAGCTCAGGAGTCTAGAACACAGTCTCATCAGCAGATTAATGGAGTAAAGCAGGTGAAGTTGAGCAAGACAAAGGAGACGCGTCGGCCGTG
GACACAACGATTCGCTCCAGAAGCGCGCTATATGAAGTACGAGCAGTCGGCCTCATACACTCGCAGGCGGCAGGAGAACATCGAGCGCCGGCGGCGGGCC
TTGCAGCCAGCGTCCAGTACGAATCCAGCTGACAGCAAGTGTATTCCCGGTTCAAGAAGGCG