Description :
From Genome Similarity Track
Location :
Scaffold_25:55146- 72234
Transcript NameFunction/comments
Phyra_77495aspartyl protease family A01B, putative
Phyra_77496B-box zinc finger family protein
Phyra_71525CTP synthase, putative
Phyra_77498Hypothetical protein
Phyra_45678caltractin
Phyra_775003-beta hydroxysteroid dehydrogenase/isomerase family protein
Phyra_77501Temptin

Sequence
17088 bases(100 bases per row)
GTTTCGGTCTGTGCCACTCAAAGCCGCTCCAACGTGCGGTTGTCGACTTTCGTCTCCTCTTGCAGTGATTTGCGGTCGAAGACCTCATCCTCCTCATCGC
TGCTGCTTTGGTCATCATCATCATCGTCTGCGTCAAGCCGCTGGTGTTTCGCGGAGCCCTTCTTGTCATTGCGAACCATCCCAAACTCTTCCTCGTCGTC
GTCATCCTCATCCTCCTCGCTGCCTTTCACGCGGCTCCAGAGCTGGTCCTTGCCTGTCTTTTGTCTCCGCCGGCTGACCGAGATCAGCATCATCAGTAGA
AAACCAACCACTAGAACTGCACCCACGATCGTGAGCACCATTGGGTGGGCGCCACCTGACGATTTTTCCTTCGCTTTCGGGTCTGCGGCAACACCTGACG
ACGACGACTGAGTCTTTGTCGTTCCTTCTTCCGACAATGGCTGAATATTCAAATCCGCCGTACTAGAAGCAAGGTCCAGAGTGGAGATATTTGCTACCGT
CGCTTCTGGTGTCGATGCAGCCGTAACAGTTGGTTCCGAGGCAGCTGCAGCGGAAGTGGGCTTCGGGGATGATTCTACCGTTGCTTCCGTAGCTGAAGGG
ACTGTTGCAGCATTGGTAACAATAGGGACAACGTTGTTCGTTTCACCATCAGTGCTACTCGTTGAATCGTTGCTGATGGACGGGGAAGCTGTTGTCGAGG
AATTGCTTTGGTAGGCACAGTCTGCGTCCACAAAACCCACTCGCTGGTTGCCAAGGTCAAAGATCACATCACGGTTCATCATGAGATTGGCGCCAATGAC
ACCACCAGAGTTCTCTGAGAGGTAAATACTTCCACAGAAGGCACCGTTTGCGTTGAGGAGGTACTGCTCAGGCGGCACATCCAGGACAACTTCAGCATTC
TCATCTCCATACGCTTCCATCACAAGCTGGATCGTGGGTAGTGACGCCATATCCTCGTTCGTGAAACCATGGCACGATGTGCCCACCTGGTAATCACGGC
CCGCGACTTCCTTAAACATCTGCAGAAACTCGGTCTTCAAAGCGCGGGGGAGGTACGAATCAGTAGTTCCGCTGTCCACAATATAGTGGCCTCGCGTGTA
TGCCTCTTCCTTGGCGTTAATAGACTTGCCCCCGATGCGAATGTCCTTCATGTGAACATTGTAGAAATGGCTATAACACATGGAACGAGTAAACCATTAA
TAAAAAACTCCACAGCGGAGCAAGCAAGCCAATTGTACCTGGCAGATCGGTCAGAGATTACTTTCGCGTAGGAAATTTCACCTCGGTGTGCATTTGTGTT
CGCTTGTCCAACCGACATGGTTCCGCCTTGATCAGTGAAGCAGAGCGAAAACAAGTTGCTGGGAATTTTGTTCTCGCGATGGAGCTTCGCAACAATATGG
TTATCCGCGTTGGACAATCCCATGATGCCATCCGCCACCTGAGTGACGAACAACCCCGTTTCCGAGCTCTGACATCCGAACTGGAAATGCGTGCCGTAGC
GGTTGCGCATCTCCTCATCCTGGAAGCTCGTTTCTCCTCCCAAGTACACGACATCCTCGACCACAGAGGCCTTCCAGCTGCTTCCCTCCATGTACGACTG
AGAGATGCCGCACGTGTCCGATGTCTGCTTGCACTCCTTACACTGAAAGAACGACTGCTGAGAGCACGTCACATGCACCAACGTGGACGAATTGTCTGCC
ATGAAAGGTTGGTCCGTGTGGCTGCCACATCCGTCGCACCCCGAGCACGGGAAGGCCATGAGTCCACTGCCTGTGTCCGCGATCACCGACGCTCTCTGAG
GCGGGGTACCAGCATATACCCATGTGTAGTGCGTTCTGGATCAAGCACACGGCTTCATTAGACCCCCCCCATCCATCACCCAACACTGTAGCAACGCTGC
ACAAGGCAGGATCAACGTACCCAAGTCCCAAATGCAGCGGCACGAGCTCCGGCGCGTCTTCTTCGATGTTCAGACGCCTCGCGTATCTCTCGGGGTGAAT
CTCGTGCTGCGGCAGGCGGTGCAGCTCCATGGTCATGCCAGCGGATTGTGCAGCCTCCGCCAGAGTAGTTATCGTCGAAATGGCAGCCAGCAACACCGGG
AATCCTGCGTACACGTGCACCATCTTGAGTCTCTGAGTGTTGAGCCCCCTGGTGTCAATTCTGCGTCGTAGGCGGTGGTTGGACGCTGGGGATCTCCCTA
TCGAACTGGGCTACGTGATGGATGGGTGCTGGGCAGTGGGTACCGGTACTAACCACACAGTGTGAGGAAGAGGGTCGCCGATGGGAGAGCGAGCGCACGT
GGCAGTTTCCTCCTCAACGTCTTGTGCTCCCCTATTTTCGCTGAAACGACGACCCAATCGTAAATGTGAAATGAGCCCAAATCGTACTTTGTGTTTGATT
TAGAATTAGTTTGGGTCCCGCAGCACAGCACGAAAGAGCCGGAAAAAGTATCTTTCAAGTGCTGACTCTCTTAGTCCGTGAGCGCCATTTCGTGGCGCAG
TAGCGTCGACCACGCGCTGGTGTCACGGCGTTGGCGTTGGCCAGGAGAGAGCAGCTCATTGCCGTCGTCGAACGTTTTCTTGGCGTTTGGCTGCACCGAG
AACGCCCGCAACGTGGTTGTGGAGTCAGCCATTCGACTTGCCAGGCCCACGAGGGGGATGCCAAAGCGAGAGTGAGGTGACCAAGCACCGCGAGGTGATG
CAGCAGTGATTGGGTCCTTCTTGGCGTTGTTCTGAACAAGAATATCATGACGGATTTCGTCCAGCAGCTGCTGGCATTTCGGAGACACGACGCGCCGGGA
CTCCATGAAGACACCCGTGTTGGGCTCAGTTGGCAGCGAGGCTTTCATACTGAGCAAACGCTTGCGGAGGTCATTCTCACCCGGTCGACGATGCTGTGCC
AGTAGGGCGGCAGCTTTTAATTCCACTTGCGAACCGTCGGGATGGCCCCCCTGATTGCTGCTGCCTGAAATGTCGCCTTCACCCGTAGCAAGGTCGGCAT
CCCCCGACACAAATGAAAGGCGGTGGTGTGGAGTGGCTAGCTGCTCTGCAGACATGACGCGAAGTTCACCTGCAAGTTGTAAATCTGCTTTGACTTGCTC
AGCACTATTGTTCGACCCGTGCGCAAACGGAGGGAAGTCACGCTGTTCCGCACGGAGAAGTTTGTGTTGGCTCCAGGCAGAGAGGAACTCCACGGCTGGA
AGCAGCGTTCGGTGATCCTCCAGGCTTTCATCCACCCAGTCGATTTGCTGTAATTGTCGTTCAAACTCGAGCGCTTCGCCAGACAACACGCGCGTTTTAA
CTGATACCGCTTCATCCAGGTTGCGGAGAGCACGTGCACACTGCTCCTTGATTGCGGCTGCGACGTGCGTCTTGTTGTCTTGCACGGCCCGTTGAACCCT
GGTCAGAAACTGTAGCTTGTTCTCGATCACAGTCTTGCGGGATGTGATCAGTGGATCAGGACGCAATGACTCCCGTAGACAGCTCTCGTACGCATCTGCA
ACAGTCAGCAGGCGATGCGAACCTTTCTCTCCAATCGAGTGGTCTCCAATCATTTTGCAGCTCACGCACACAGGAACCTGGCACACGGGACAATAAAACT
CCACTTTCTTGCCACGGTGACAGCGGCACGTTGGTGTCTGTGTATCATCAGCCAGGAGACCTTCTTCCATTTGCTTTACAACGATCTCGTTGATGTGAGC
CTCCGTCGGCTCCGCGCTGCTTGGCGGGTTCACGAGACTTTCCACGCCTACTTCCGCAATGGCAGTAGCAAGAGATGGCGTTGAGCTTCGACGTCTGCCG
CGTCTAGCACCTCCGCTTGCTAAAGCTTTTGATTTACTGCGCAGAGGCGTACGCTTGTGTCGACGTACCAACTTGTTTGCCGAGTGGACTTCTTGGTCGC
AATGAGCACAGATCTGTGCCTCGCAATTACGGCAGACAACAACAGCGGGGTGCTGCTCACATAATGCACATGATCCCACGGCTGGACCATGTGCATCGGC
TGCGGAGAAGGTGAATCGCACGAGGTACTGGGGCAAGACCTGAAGTGTGTTGTTCAAGATGTACTCGTGGTAGTAACCGCGATCCAGCAGTGCAGACTGG
AGATCACGCTCCTGCTCCTGCTCATTCGAGCTGGAGCCTTCATCACGGTGCAAATAGTAGCTGTGGTAACCAGGTGGAAGGCGTGCTTTGGCCTCTTCCT
CTTCATGAATAACAAGAGATCGTCCAACCGCAATCTTGCAGAGCACGAGCTGCCGCGTACTTGATGGCTTCTTTGCCTCTGCTGGAGGCTCCGGAGGAGG
TGGAGCACTGAGCTGAAGGTTTCCTGTGGTGAACTTCATCCCCGATTGGTTGGCATCGAGCGATGTGAAGCCGTAGCTGTGGACGTCACCCATGTCAGCG
CCAAGGTCGTTTACGGCGACCCACGACTCGAGCTCTAGCAATCCTGCCGTGTGCTGCTCATACTGTGCCACCAGAGACGGATTGCGCATATCCCAGATAA
CAACGCCCTCGTGCACACGATACCCCGGCAACGAGCACTGCAGCAAGTACCTCACGCGTGCAAATTCCTTGGAAGACTGGCTCATCGGCGTCACACTTGC
CACTGCTCCTGCGGCAGGAATGGTTGTCTGCCCAGCTTCGTCTTCTTCGTCATCCACTAAAACTTCAGGATGTGACCCCGTTTCGACGCCCCATTCAGAG
TATTCGCCTGGCGGTGCTGCTGACGAGGTGACTTGCGAGCTAGCGTCGTCGGAGCCTTCATCTTTTTGAGCCCCCTCCACTGGACGCTCGGGTGATGCAG
GCCGAGCAGCCTCGCCTGGTCCATTCGGGGAATGCGACGACAAGAACAGCCGCAGTCGCGCAAGCGAGGCACTTGCCTTCGCCTCGTCGGCCTCGTTCAC
TACCATTGGTACCAGAGTTCAGCCAAGGAGATGATCGTCGGTGCGTTTTAGATGCCGTCGTTTCGGATGTCCTTTCGTGAATTGCGTGAGTACAATATTG
GATTGAGCTCACGAGCTGGGAGCTGGGGTGGTGTATCTTCCTTCACTTGCAATTTTGCCGTGCGGCCCAATCGCAGTCACCCCGATAGAGCAGTGGACCA
TAGTCCATGAAGCGCCACGCCTTCGCAGTGTGCTACTAGTAACGTAGTCTTAAACCGACTGCACTACGCTCATATTTGCTTTAAAGCGGACACAGCGGCA
ACATCGCTAAGAGCAATGCAATGCAAAGCGACAGGCACCATAAGCTCCAGCTGCAAGCAATAGGTCCTCGCCGCAGCAATCCGTTGACAAAACGGTCGCG
GTCGTTCGAGATTGCTGCAGCAGCCCAAGGACAACCAAAAACTCACGTCGCAGCATCAATTCCGTGCTGCAAAGGACCATATTGCAGATCTGGTCGCTCC
CAGTCATCGGCACCAACTCAAATCGAAAGCGCGCCAATGGGACACTCAGTTCCCGCCACCTCCAGCCGTCCAACCAATTCAAATGGCCGTTCTCTCTCGC
GACCAAGCGGGTTTCCTTTACGGCCCGTTTTCAATACAAACCCAAGTCAAATACGGAAATGGGCCGTAATTTTGGAACCCGTAGCTCTTCGAGTCAAAAA
GGCGTGCGCAGCCATTCGGCCATTTGCTTTGTCTACCCATACATCCCACCATGAAGTACCTGGCAGTGACCGGCGGCACCGTGAGCGGCCTGGGCAAGGG
CATCACCATCAGCAGCATCGGCGTCGTGCTCAAGTCGCTGGGGCTGCGCGTCACGTCCATCAAGATCGACCCGTACCTCAACTGCGATGCCGGCACCATG
TCCCCGTTCGAGCACGGCGAGGTGTTTGTGCTCAACGACGGCGGCGAGGGCGACTTGGACCTGGGCAACTACGAGCGCTTCCTGGGCATCACGCTCACGC
GCGACCACAACATCACCACGGGCAAAGTCTACACGCATGTGCTCGAGAAGGAGCGACGCGGTGACTATCTGGGTAAAACGGTGCAGGTGGTCCCCCACGT
CACGGACGCCATCCAGGACTGGATCGAGCGCGTGGCCCAGATCGGCGTGGACGGCAAGCACGCCGGCGAGGCTGCCGCTGTGGACGACGAGGCCGCCGAT
GTGTGCCTCATTGAGGTCGGTGGCACGGTCGGCGACATTGAGAGCATGGTGTTCCTCGAGGCTCTGCGTCAGTTCCAGTTCCGCGTGGGCCCCGAGAACT
TTTGCCTCGTGCACGTGTCCCTTGTCCCCGTGCTCGGCTCCGTGGGTGAGCAGAAGACCAAGCCCACACAGCACGCCATTAAGGAGCTGCGCAGCGCCGG
ACTGTCCCCCGACGTCATCATCTGCCGCAGCAGCACCGAATTGGAACCGGGCACCAAAGCCAAAATCGGCATGTTCTGCCAGGTGCCGGCCAACCACGTG
CTGTCGGTGCACGACGTGAGCAACATTTACCACGTGCCTCTGCTGCTGTCCAAGCAGGGAGCTGCTAGCATTCTCATGTCCAAACTGCAGCTGATGGACC
GCTTCTGCGAGCCGGACCTTGAGGCCTGGTCAGCCATGGCCCACCGCGTCGATTCGTTCGAGCAGGTGTGCAAGATCGCGCTCGTGGGCAAGTACACGGG
TCTGCAGGACTCGTACCTGAGTGTCATCAAGGCGCTCAAGCACGCCACCATGAAGTGCAACCGTGACCTAGAGATCGAGTGGATCGAGGCCAGCGACCTG
GAGGTGGACATGCGTGAGAACGACCCCAAGGCCTACGAGGAGGCCTGGCGCAAGCTGCGCAGCGTGGACGGTATTGTCGTGCCTGGCGGTTTCGGTGACC
GTGGTGTGGACGGCAAAGTGCTCACGGCCAAGTACGCTCGCGAGAACCGGATTCCGTACCTGGGTGTCTGCCTGGGCATGCAGGTTGTTGTGATCGAGTT
TGCGCGCAACGTGATCGGCTGGAAGGAGGCTAACAGCGAGGAGTTTGACGCCGATGCTGAACACAAGGTGGTTATTTTCATGCCTGAGATCAACCCGGAG
GTCATGGGTGGCACTATGCGCTGCGGTGAACGCCGCACGATTGTGCACGAAAAGGAGGACCCGGCGAAGCGCTCGCTGGTGTCTTACCTGTACGGTAAGG
ACAAGCCGATCCTGGAGCGTCACCGTCATCGTTACGAGGTGAACCCGGAGCTTGTGCCCGCCATTCGTGAGGCTGGTCTCAACTTCGTCGGCACGGACGA
GAAGGGCGAGCGCATGCAGGTCGTGGAGCTCGACCGCGACGTGCACCCGTTCTACTTCGCCACGCAATACCATCCGGAGTTCAAGTCGCACCCGAGCGAC
CCGTCGCCGCCGTTCCACGGCCTCATTCTCGCTGCCACCGGTCAGCTCGCCCAGTTCATGAAGGACGTGGAGGCCAAGGAGCAGGAGCTGTAAGTGCTCG
GGCGATTCGAGCTAGAGGCGGTGGAAATTGCTGCGACGCAGAGCAGGTGGACAAGTGGCGCGGCAGGACGCAACGACGATGCCTCTCTCGCAGCAGGTTT
GCGTGTGAATAGGCTAAAATATTGATTTGGACCCCTCCACTCCGATGTCTTTGCCTTTGTTTTTCTTCGTCGAAGGAAAACGGGGCGAAGCTCTCTCGGT
GGGGTTCCGTGACCAGCCCACGGCCAGGTAGAACTAGCGTTAGACCAATAGACATATATTTATTCCAACTCAACCGTCTGATTGTCCGCATGAACGCCAG
CGAGCCCAGCACTAATGCTTCGGCCACATCGTGCTGACGCACTTGGTCCAAATGGCTACATCTGAATTTGCTCATTTTCGGCGAATCAGAATGCTTCGAG
TGGCACTCAACGTGGCATTTCCGAAAATGTCTGAAGAGCTGCAGGAGGCGGTGGATGGCTTCTTCCTGGCGGCGGAATACGGCCGCTCCGACGTCATCAA
GGCACTGGCGGACCACGGTCGCGGACGCCTGTCGCTTGGAGACGTGGTGGATCCCGTGACGGGGCGCTCGCCGCTGCACGTGGCCGTAGCGAGCAGCAAG
AAGGACGCGCTGCGGGTTCTGCTGGCCGCTGGCTTCCCCCCGCACCATCAGAGCAAGCAACAGGAAGGAAAATACACGTTAGAGGGCGAAAATCGGTCGG
CGTACGCGCTGGCGCAGCAACTGAAGTCGCATGATTTGCTGCTGGTGTTCCACCAGTTCCTGATCCAGCAGGTCGCGGCCAACGACGTGCAGAGCGTCAC
ACAGTTACTGACGGCTGGCGTGGATGTCGGCGTGACGGATACAGCCACGGGAGGATCGCTGCTGCATTGGGCGGCGTCGTGCCAAGCAGTGGAGGTGATG
AGGGACCTGCTGGAGAGAGAAGACGTTCAGAAGCAGAAGCTCGTGGATGCTCGCAACGGGGAAGGAGCGACGCCACTGCACTTGGCGTGTCATGCGAACC
AGGTGGAGTGCACCAAGCTGCTGCTACTGCATCATGCTGATATAAGTGTACGGGGTGAGAAGGGGGTCAGTAAGGACAAGACGGCGTTGGAGCTGGCTAC
GATGGCGGAGGTGATAGAATTGTTCTCTCAAGGGCTAGGAGGGAAGAGTGAGGTCAGCGAGCCCAGGGAAACGCAGAGGGAGGCTTCAAAGGAAGGAGAT
AAGGATGCAAGCAGCAGTGATGATGTGTCGTGCAGATTGATGACGGTTGGTGGTGAGCGTTCTGGGGCCTGCCCACATGAAGCGCAGAACAGCAAACTGT
TGCTTCAGCTCGAAGAAAAGGATCTCCTGGTAAATCAGTTGAAGAAGACTATTGAAGTTCTCGTGCAAGAATCACAGGAAATTCAAATGCTCGGAGAAGA
GCGTGTGATGCTGGACTATGTGCGCAAGCTGCGCGATGAGAAGGCTATTGCCCAGAGGCAGATTGAGGATGCGAACGACTACATCAAGGACCAACAGCAG
CAACTCGAAAGCTTGAAGGAGCAGATCCGACAAACATCCAGTGCCACCAAACAGGTAAGAAGATTGTTGCTGGCGTTAGTTGGCTGAAAGTGGTGTTCTT
ACGACTACTTCTTTTATGTAGCAGCTTGAGACTGACCACGACATTCTCTCTCATACTAGTGATGGTACGGCTAGCAGCGTCGCTGGGGCCCCTCCGAATA
GCTCCAACAGCAACACGAATGCGCTGGATTTACACCAGCTCGATACACAGTTTGATGAAGAGGACGAGAACTCACAAGAACCCCGAGCTCAAGCACTGAA
GTTAGATGCCTGGACATCGAAGGCTCAACGTGAGCAAGAAACATTCAATCGATACGTCGAAAAGCATGGTCCTGACATTTGGAGTACGGTGTGGAACGGT
ATCTTTACAGGCAATGAAGAGAAGGAGACGCACGATGAAGACGGCGAGGTCATCATGACGGTGTAGAATGAGAAACAAAGTGAATTGAATGATTTGCATC
GATGGAAACCCAGCAATGATTGTATCCCGCTACCGCATTGGCGAGGTAGCAGCTGCAGACGTATCCTGCTGTTGCTGCTTGTAGACGCTTACGAGAAGTT
TCTCCCGCTTCTTGGGTTGCTTGTATAGTGCACAATTGTTTGCGCACAAGTGTGGCGACGAGATTGAATTTTGTCCATCCTTACCACACGAGCAAAGAGC
TGGGGTCCCAAGTTGCGCTTGAAGTGCACGAACATAGCGCTCGTGATCTTTTGTCGCTGCTGATCTCGTTGCACTCTTCGTTTTTTTCCTTGTGAAATTG
CAGTGAATGACTACGAGCAATTCCAAGGTGCATGGCAGTAAATGTGTCTTACCTCCACGGAGTCGACGATGTGGTAGTCTGACGATGTGCTCGTGCCTCA
CATCCCGACGATATATCAACACTGGCCACGACAACGTTAGCTCCAAACGGACCATACCAAAGAGAAGGACACTTCCCACGCACACTTCGACACCCGCGGA
GGTGGTCCATCGATTTCCACCGCTTTCGTCTCCCGCCTTGCTAGCTCGACGAGCCCTGCTACCACTCACAGCTGCTGCAACGGAGGAATTTGAGATCGGG
GACTTGGCTTTGGTAGTGCTGGGAGACTGGGAAGCTCCTCGCCAAACGTTGCTCTGAGCTTTGGCTCGATTCATCTCCATGTACTGTCGCCGCACCAAAG
CATACAGAGCGACGCGCTAGTGTAGTCAAGAAATGTTAGCAACAATTTTAGATCGACTTACCCGAAGCCGAATGGTGAACGCTACACTTACCTGCTCAGG
CAGCAGAGTCGGAGATTCAGTTGGTTTGTTCTCGGTTTCACTCTCTGTGTTCTCAGCAAAATCGTTGCTAAGAACCACTGAGCGTGCAATCTGAGTCGAT
TGAAGGAGTTCGTCACGAATTTGGGCATCTAAGCGAAAGCTCTAACCGCACATAGAGAGATACATTCACGTGTTATATTCATCAGAAGGCAAGGTAGAAC
CTAAAATGCAACATGTTACCTTTTCGATTTGATGGCCTAAAGGGCAGCTCTGGTCGAAACAAGTGTAAGACGAGCGAATTGAATCAGTGTGAACAACGTA
GACAAACCTTTAGTACGGCCCTCTTCTGCTCCTTCAACTCCTGAAAGTATGGACGGGTCGAAATTCGCACCGCTGCTGTGCTTTCAGTTTGCTGCGTCGA
CTCTGTCGTCGAAAACAATTTTGCACACTTTGCATCCTACTCGGCGATGTAAGCTCGAAGCAGCACTTCCTCAAAAAGGCTTGGAGCCACGCACCAAACA
TTTCTGCGTTTTCTGGGCTTCAAGGCGATTTTGTCGCTCTCGCGCTGTCACGCGCACGCAGATTTTGTCGTGGAATCGTTTTAACTCGTTCGACTTGACA
CGCAATCGGTCTTTGCTCTCCTGCCGCATGGACTCTGCTTCGGCCTGCCCACAGTGTGTGGTGTTATTTTCTCTATTCAAACGCCATACCTCTGAAGGGA
AAAGCGTGTGATCACCTCGACATCAACAACACTAAGGTCAAGCCAGTCGGATTCCTCTTCATCATCTACAAATCTATAATCTCCATATTTACCCCTGTAG
AAAACAGAAACATGTTAGCTTTTTGTTGTCGCCTACAATAATTCTTGAAATGGTTTACTTGTCGACATGGAGAGTGGGCATGGGAGGTGAAGGATAAGCT
TGAAAGCGTGCCATGGACCGACATGGTGAGCAATTCTGTTAGAATGCAACGAGAAGTAAACATACGTCTCTCTCTTCTGTGTCTGACGCATTCATTGCGA
CTACAATCTTGAAAAGACGCACACAAAATCTGCAAAAGGTCGCGACGTTCATTCGTGGGTAGACCAGCATGCCAATGACACAGTACTATCATGTGCGCGA
TCCTATGGAGAACCTACGCATTAGCGTGACAATACGCAAGGTCGGTAAGCGAAAGTAGCGCTGAAAGGGAGACGCTCACAGGCTAACTGGCGAAGTGACA
GATCTCCGGGTTCGGGAGTGATTCAAGTGGAGACTCGGTTCCCGTGGGCAGGACATGGAAATATTGCTTCCGGTGGCAGGAAAAAAAGCTTAGCATGAGG
TGCGTGGATGGTTGTACTGTCAGCAACAATAGCAATGCAACTGAGAGCAGTTCCTATTGCATTGTACAAGTGAAACGAAGCGAGAGCAGGAGAGTCTGGA
GGCAAGGGGGATTCAGTTGTCGAATCGAAAGGTGTGTACAATGTTGCAAAGAATAAACGATGCAACATACAGATAGATTTTCTTTGAAAAAAATGCAGCG
CGGAGATAGAAACTTACCCAAGATTGCCAACGCCGATATTTTATCGACATATGTCGATGTCGACGACTACGTTCCAAAAGAGGTGGGCGCTATAACTTTA
TGTTTTTACTTGCTGCGGACTCAACAATGGGATGTACCATTCAAAGGAGCGACCAAGCACATCGATGAACACAACAACGCACCTCATTCCACCAGATCTC
ACTCGACGACCGCGAGACAGACGAAATGAATCTTCATGGACATCAAACCAGCATCGTGCGTGGCTCCGAGCAAACCGTGAAGATAAATTTCGCGCGATGC
ACATTGTTGCTCTTATCGAGGAGGTGGAACGCGTGCTTTGTTCGTTCCGGTTTTACAAGGAAAGCGGATTGTTTTGTGCGACACCAGGATTTTCAGCGCC
AATCGTCGACCCTGAAAGCGATCCAGACTTGTTCGTAAAGGGCCCCAAGCTCACCACGTTTCACGTGTCAACTCCGTCGGGCTCCCTCTATGAATACGTG
CTAGACAACACAAATGACCTACTACCATTTGCCTCCGCTGAGGACCAACGTCTTGCACGAGAAATCCGCTTGCAAGAAGAAAAACGTGATACAACTGAGG
TTTCTCGCTGGCAACAACTGGATAACCCCCCCAAACTTGTCGAAGCAAGACCTGGTGGCTCTGGAAATACGAAACGCAAGTTAATGTTATCACTTGAAGT
GGTGACTGTTGATAATCCACAAACGATGAATCCGGTCTTTGTGGAGTATAAACTTGTACTACCTCACGGCATGGGTCATCTCGATTGGAAATTGCAACCT
GGAAATTTCGACTGCAAACGGGGTAGGACGCCGCTATCGTTGCCTCAACAATCCCCATCCACTGAATGTGGGTCTTCTTCGGCAGCGTTTGGATGGCTTG
AACACTTCGACTTAAAACTCATCGATGTTGAGAAATCGCTTTTAGCAGCAGAAACTTCGTCCCAGGCAGCTAGAGATGCTGATTTCGGCAACATTATTCC
CGCTCCAATCCTTTATTTGAGCGTGTATTCACTGGATTGGTGGCGCCGAAAGCACACAGAGGGCCATGGGGAGATCGAATTGCAAGGATCCTCCGGATTT
TACGACTTTGATGTGCCTATCCGGAAACCGATTACTTCCATTCGTGATCACATGGAGGAACTTTTTCTTGGCATCGGTGACAGTGACACCGACCAAGACT
GGAATGCAGATCGATCCCATGACCGAGAAATCTGCACTGACGAATCTCCGATATCGACTATCATCACAAGCCGATTGGGGCAAAAGTCAGAGTCCACAGG
CTCCACCGTACGAATTCGTTGGAGCATATTTGACCTGCGTCCAGCAACTCACGCAAACGGGATAGTAAAAGTAATGCCAGCAGCTTCTGTTGCGCCCTTG
GCTAATACGAAGGTTGTCAAGCGAAGCGTGCAGGAAATACTGCAATCAGTAAAACTGGAGAAGAGGTTGGCTAGTATACCAGATGTCCGTGTCCAGACGG
CTCTGCGCTCCGTGCCTGCCGGCGGAGTGGCAGCAACAGAATCACTAATAGACCAAAGTGCTCTAGTTTAATAGCGACGGCCGGGAACGACCTCAAAAGT
GTATTGCGTAGTTGAATCGGACAGACAAACACGCTTACTCATCGTCACTGTCCAGATCGTCCAGCGGATTGCCGCTGCGCTTCTTCATGACGCGGAAGAA
TTCCTCCTCGTTAATGAGCCCGTCTCCATCGCGGTCGGCTTCGTCGATCATTTCTTGCATTTCTTCGTCCGTCAGCGATTCTCCTAGTTCGGCGCACACG
CGCTTCAAGTTGCGGAAGGAGATCTTGCCCGTGTTGTCGTCGTCGAAGAGCTGGAAAATCTTCATGATCTCCTCACGCGAGTCTCTCGAGTTCTGTCAGA
GGACACCAAGAAGACAGTAAACCTTAATACATCGAGCCGATTCTCCCCTCATAGTCATTGCAACGAACCATTTTCCCGGTCATCATCTCGATGAACTCGT
CCTGGTTAATCGTTCCAGACTCGTCCTTGTCGATGTCTGCAATCATCTGCCGGATCTCTGCCTTCTTCACCTGGAACCCCAGTGCCCGCATTGCAGCCTT
GAGCTCACGCACGTCGATAGAGCCACTGCCGTCCGTGTCGAAGAGATGGAACGCCTCCTTGATCTCTTCCAGGTCTTCTTCGTCCAGCACCTTCTTTACC
GGCTTGGGCTTGCGGCGCAGCGCAGCGCGAGACCGCGCAAAAGCCGACGCGGACATGGTATTCGACTACCACGAAGCACAACATCAGTCCGTCAAATGTA
CGTCGTCACGTCAAGCATGACGCTAGACAAACGTACCATTTCTCCAGCGAGCAGAATCGAAAGTGTCCGTTGCAAACCAATGGCGACCTTTCGGGTGCAC
ACTTCAACGTGGAGGTTCTACTTTAATGACCGAACCTCTTTCGTAAATTACAGAACCCGGTTTTCTATTCCGGTTCGTGGGTCAGACAACTTCCTTCCTG
CCGTCACACTCTTCAATTGACCAGCACGCACTCACTTCCTACGACCTTTCAGCGCGATGCTATCGGCAGCAGCGAAGCGTATGCGACAGAGCACCATGCA
CACGCTCAAGGCCTACGACAAGAGCGAGCACCGGCTGCTCGTCGTGGGCGGCAATGGCTTCGTGGGCAGCAACATCTTGCAGCGCGCCGTGCAAAAGGGC
ATCGAGGTGCGCAGCCTTAACCCGTCGGGCAAGCCGCAGTGGCAGGACGTGCCGTGGATCGACCAGGTGGACTGGCACGAGGGCGACGTGTTCGATGAGA
AGCAGCTGGCCAAGGCCGTGGAGGGCGTCACGGGCGTCAGTACGTGCAGCTCTCCACAGACTCGACGTCTTTTGTATTGACGACGCATGGTTGCTGTTGT
TGTTGTGTAGTCTCCACTGTAGGCGCGTTCGGCAGCAACGAACTGATGGAGAAAATGTGTGGAGACGCGACGATTCTGGCGGCGAGAGCGGCGCAGAAAG
CAGGCGCGGAGAGATTCGTGTTTGTGTCTAACTCGCGCGTGGGCTCGTATTTCCCGCCGTGGCTGCCGATGCATGGCTACTACAATGGAAAGGAGAGAGC
CGAAGCTGCTGTGCACGCGAGGTGAGACGTGAACTGACGGCATCTATTGGGTTTATTCTGTTGCTGACAATTTTTCGTGCACTGTCAGATTCCCAAACAC
TGGTGTGTCGCTGCGTCCGGGTTTCATCTATGGATGGCGCCGCACGAAGAAGGGTCAAGGGATTCCGCTGCAACTTGCAGGGGCTCCTCTTTCGACGCTG
GCACGCGACCTGGGCACAGTTTCAACAGCGCTGGGCTATGTGCCGTTCGTTGGTGAGGAAATGAAAGCTGCTATCCCTGTAGGTGCCGTTGCCAAGGCTG
CAGTGCTCAGTGCGATCGGCCCTGTGCACGGACAAACGCTGGACACGACGAGCATGCTCGAGATCGCTGCCTCTTTCCACGTCCATGAATAAGAGTGCGA
TGAACTTATCCAGTCGACGAGGGCAATGAAATCTGGAACCTAAATCAATTCCAGCGACAATACCATAAGGCCAACCTCCTAACTCCAAAATTGACGGGTG
AACTCAAGGAGGGTATGACAAAGCTTTCATTACCGCGTTTATCTTTTCGCCATCGCCTGAGCTGTGTACTTCATGCCTATGACACCGATTTTCTTTTTGC
GATCTTCTGCTTCTTGTCGTCGCTTTGCTAATTCCTCCGTCCGATCCTTCCAGTATTGCTGTGAAGATAAACGCAACCATTCCATAAGCCTCACGGATAT
CGCTGTTGCAGCTCAACAGTCATGGCGTACCTCTTTCTGCTTCTCCTTCTGTTTCCCCAGATTTTCGTTCAAACTCTTCGCGTCAGCTTCATTTTGCTCT
GCTTGACCAGGTAGACAAAGCTCTTCCAGGGTCTGCACCCAGAGATCACGGACGCTTGTCGCTCCAGCTGTGAGCTCAAGCAGTTTCTGGCCATTCTGCC
CGAGCAGTACTAGATCGAGACGACCTATGCTCACAAACGGCCTTGTTAGCAACAACACGAACCAGCAGAAAATGGCTGTACGTGCCGTACCCATGGGACA
CACTTTGCCAATCTTGTGAATCGGCAGTTCCTCCGAGTTACTTGGACCGGGCGTCTGGCGCCACACGAGCCTGCCGTTGATACAGATACTGGTTCAGTGC
TCGCATATCATTCAATTTTGCCGTTCTAGCATCCTATTCAACCTCGTAGCTGACGGGTTCAGCTGTAAGTAGACACTTTCTGATCTGCTGAGCACCCCCA
GAAAGGAACTCTTTTTCTTGAAATCGTTGCCTTCTTTGAGCAGCTCCTGCCTCGCCAGCATCTCCGAGTCGCCACCACCGCAGCACACATTGCCCATGTC
CTTTCCTCCTGTAGCAGGGACTCAAATCAAAAATACAAGTCGACTAGAATAGGTTGACAAGCAGTGTGGAGTGCACGTGTATTTCTCAAAGCTTGTTGGA
GAAATCAAGAATGAAATCGATACAGAACAGCTTTTCTCGCTGCTTGGCGCGGCCTAAGCGATGCTAGACAGAGAAAGTTGTCGGACAACATAGAGACGTG
ATGCTTATTTAGCGGCGCAGAGACTTGGTAGCAGACTTGGCAGCGCAACCACCACCCGAAGTCGGGATAGTGCTCGAGCCCCATGGGGAACCCTTCGTGG
CATCACCCGCACCACTGGTAGAGCTCGCGGGGGTAGCAGAGGAGCCCCCGGTTGAGCCTGCTGCGCTCGAACTGGCATCGGAGGAGCTGGGAGCAGACCA
CCCAGTGCCCTTGGTGGCATCCGATGCTCCCTTGGTAGCATCAGAGGCTCCAGTGGTTGAGCTCCCTGCACTCGAGCTAGCATTCGAAGACGCAGGCGAG
CTGGCAGCAGTCGACCCAGCGGCGGAAGTGGTGGAGCTAGACGCACCACCTTTCGAGGCGCACGTTGTGGCCTTGCCCGGAGTGGTCGTGAAAGCCGTCA
CCGTGAAATCGGGCTTACCGCCCTTCTTCCACGTGCAGCACGGGTCACCAAACGCTGCACCGTTAGTCATGCTCGAGCTCGGGAACTTGGCTTGGCACAG
ACTGCTGGACCACGTGTGACCGGCAGCAGCAAACGCTTGAGCAAAATCCGTCGTCTTGGAGCTGTCGTCGCCAGGGTGACCGAGTGCCTGCTGGAAGGAG
GTGCCGTTCGGAAGCTCGTTGAGGTACTTGGCGAGACCCATAGCGGGATCCACCGTGGCGGCGATAGTCAGAGCAGCAGCGGCGATGGCAACTTGGATCT
TCATCTTGGTATGGCGTGTTCTGGTTCTGGCGGTGCGAGGTAAATTCAGGAGTGAGAAGTGAGAACTTACCCGTGTTGACTTTTCCGA