Description :
From Genome Similarity Track
Location :
Scaffold_47:55136- 58120
Sequence
2984 bases(100 bases per row)
CTATCTTCCGCATGCATTTATCTTACTTGCATAGCTGACGTACTTTCTGACTTATGTGTATAGCTTCTGACTGACAGAGTGGCGTAAATCCTTTCCGACT
GACATTATACTGGGTCCGATATGTACGACAAAAGGCCTCGTCCACATCGGATGAAGAGGCACCACTGCGTGCACATTCTTTTGACCGGCTGCAGCATACG
AAGATATATGGCTGTAGGCAGAGTATCAGATCGTAGTGATGGTTAGACTTGAATTGAATAATAGTTCATGTACATTAGATGGAGTACTTTCGCTGCCTAC
TTATCAGCTCGGCGTGCTATTTGATGTGTCCGTGCATATCCCGCAATGCCGCCAATGGGTGTTGTCGTGATAGCCAACACCCATGCACTGGGTTACTGCT
GCGATCTCGGTACTTCTGTATCGTCGTGCTAGCCGTACTGTACCTACGATTATGATGTATCCGTCTATATGAATTCAGCACGTCACTATTCGCGGCCACA
GGTTCATATCCCCGGTGATACAAGCAAGCTGATCAGGCGTCTGTTAGCAGTATTCAAAGCAATATATACGCGCGCGGCGGGTACACATTATAGCCATCCG
TGACTCAACCGAGCTCTTATCTCGGCCATTATGGACAGGGCGCTAAAGTAAAGTACTGCGTACAGACACATCTCCTTGCGATGGCCGCTTGTATGGTCAT
CACTACCGCATACGTGGTTGTGTCCATGTAGACAGCAGCTTATTCATCGCGCATAGTGCTCACTCGATACTGAAGCTTACATTCGTGAGCGCACATTAGT
GAAATATAAACTGTGAGGGTTGGTGGTACATATAGCATGGGTTTGCGTGTGCCAAGTGAGCAAGTGTACTTTCCATCTACGGTAACGCGTATGCAGATAG
GAACGGCCAGCTCGCAAGGGTACACAGTAGACACCATGCGCTAATTATTATACGAAACGCGCTACACTCCGTAGATGCTTGGCAGCACCACAGTTAGTTT
ACCATATGTGCGGCCCCAAGCCTCGCGCCGCCCGCCAGTATACAAAATACAAAGATAAGCGGGGTAACGGGGGCAATAAGGATATACAAATTACTTGCTC
TTCTGCTCGATGTAATTGGCGTTTCGGGCGGTCAGCTTGCGAGGGCGGCTGCGCCTCTTTTTCTTCTTGGGGTACCAGTCAGGACCCATCGCCTTCTTGA
CGTTCGCCAGGCTTTCCTGGCGGCGCACATCGGCCGAATCAGGTGGTGGGGGCTTTTCCTCCCAGAGCTCAACCGCTTTTGGGCCGTTCTCGCAGGCAAT
ACAGCGCCGCACGATGTCCCGCCCGCTGATTGTACGGAGTGCGTAACCGTACTGCAGCTTCCCGCAGCCGACGCAGCGCGCCCGTGCATCCGTCGTAGAC
CGCTGTGGGTTCAGCAGAAGCGCCTCGCATTGCTTGCACGTAGGGCCCACCATTTTGCAAACGTGCGGATGTTAGCAAAATATTTTGTTTTAACCAATTA
CTTGCGTCCAAATATTAGCCAATAGCTTGGAAATATAAGGCTGGTATTTATTATTTAGAAACATATTAAAAAGTTGATACTAACGTTTTGGCTTTGCTAT
AATATATTATTATCAGATTTCCAAACAAAAACATACTTTACATGCAATTTAAATTGCCTAAGACAATTATCTATCGTGCGCGCATGCATTCATCGGGTGT
GGTGCACGGGAGCAGATAGCGAAATGCCCGTGCAGCTGCGCGCCTTCATTGCACGGTGGCAGTGGTGAGTTCCAGGTAAAGTACAAAATATATATTCGCA
AAGTCGCTACAAAAAGCGCTGGTCGTGAAGTCTACTTTAATATTAAAAATACTATCGTCTCTACTTTAGAAAATGTGTGGAAAATAGCATCGCCGAGCTC
TTACAAATGCGGCCTGTGAAGCTTATATTAGTAATATTAATACTATTGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAAGGAACCGGACGGACTTATTGACAGATGGACGGACACGCTGCAACTTTAGGTGGCGGGAAACTAGCGCTCTGGGCGCCCGCTCC
GCGGACGCTAGGGCATGGTTGGTTGGTGTAGAGAGGGTTGACCATCTCCGCTGCACTGCAGTGGGCTTAGAGTTTCTACTCAGCGCAAAGCTACATGTAA
TAAGTGCATACTGTGCTATACTTATGTTACGTTCCAAAACAACTCCGCATACAATAGCCTTAGTGTTCACATGTTATGGTAGACATGACCAGGATTTAAC
GTGATCTGCAAGAAGAGCACCATCTTACCCGGGAAGGCTTTGTCTATAATCTCGTTTGAGCGTATTGCTCCCAAAATGAAACGA