Description :
From Genome Similarity Track
Location :
Scaffold_860:5513- 10260
Transcript NameFunction/comments
g16223.t1ETI34642.1 hypothetical protein F443_18889 [Phytophthora parasitica P1569
g16224.t1hypothetical protein

Sequence
4747 bases(100 bases per row)
ATCAGTGCTTTGAATGGAGGCCAGACTCCACTGCATCCCGACACTTTAATATCTCAATCACAACTCAATTTACCTGGTCTTCCCCAAGCTCCCTCACTTC
ACTCCTTCCATTCAACGACCTCTGATAGGTTATGAGCCCAACGACTGACTCAAGCGCAGACGACCGCGATTTCCCGCGCCTTAATGGGCGGAATTTCGTC
ATCTGGAAGACTCGAGTGACCGCCGCCCTTGAAGGCAAGAATCTGATCGGCTTCGTCACCGAAGCCGACTACGCGGGCGACGAGGACTACGACTTCTCCT
CCGATGAAGACCTCAACCCGGCACTGGCCGACATGGGGGACATTGAGGCCGCACTAGATGCCGTTGGGGCGCCCAAAGCCACCGACATGGAGGACTCCTC
ATCGAGTGAGTCCTCTTCCGACTCAAGTTCGGAGGCTGCCACCGCTGGAGACGACGGCGACGTGGAAATGGGGCAGGTACAACCACCCTTGATCCAGTCA
TTCACCGCTAAAAAGCGTGATGATCTGAAGCGAGCTGAGAAGCTAAAGGCCAAGAGCCTGAAGCTGAGCTCGAGGAAACTACGGCTCGATGAAGCAAAGG
CTAAAGCCTTCCTCATCAAAACCATCGATGATCAACACGTTCTCATGGTGAAGGACAAGACTACGGCGTACGAAATCTTTCAAACGCTCTGTAGCAAGTA
CGAAGGTGCTGCCATCCACGGTGACCCGTACTACATCCAGTCGTACCTGATGGCCCTCAAATACGAGGAGGGATCCGACCTCATGGCTTTCATCATCGAC
TTGGAAGAATCCATGAAGGCAGCCGCGGAAGCCACGAACAGTGTGCTGAGCGACGAGCAAAAATCGCTCTATCTGTATCACTCTCTCCCAACGGAGTGGA
AGCCTGAACTAGCAGTCTGGAAAGGCAGTCGGAAATTCATTCCGTACGAAGACCTGAAACGGCACATCGAGACCAAGGTCCAGAATGAGCTAGCGCGCAA
TCGCTACGTCCTCAGACAAGGAACCCCAGAGTCTAAGGAAACACGAGCTGAGAGAGCTCTTCGAGCCACGGCACCAATTCCGATGCCAGCGGATCTCCAA
ATCCCCGCCAAGATGGAGACAGCTCTCGTGGCTTCATTGAAGTGCACGTACTGCCAGCGTGACAACCACGACACGGTCGACTGCTACATCCTGCAGCGCC
ACCTACGTGATGGCCAAATCAAGGCTGGTACGGTTCTGCCTGCCAACTTTAAGCTCAAGGCACCACAAGGCACGCAAAGCCATCATCCTTACAAGGGCAA
CTACAAGGGAAACCGTGGCAACAACTCGTGGACAAACTATCATGGTCGTGGAAACAACAATCGCGCTCCTAATGGAAAACGCCAAGATCGCCGTGGAAAT
CACAGCCGTAACAACCAAGGCAAGCAAAACGAATTTCACGGCCGACGCAACCAAGACGCCCATGGATCGGACAACAACGAGTATGGCATAATTGCTATTA
CAACGCTCGATTGTTCCCCCAAAACTGTGGAAGTGAGTCTCACTGCTCATGTCGGACACCATGATCCATCATGGACGATCGATTCCGGCTGCACTCGCCA
CGTCACGTCCAACAGAGAATGGTTTGTGACCCTAAAACCGACCGCGGGTAAGTCCATCACGGTGGGGGGCAATCACCAGATTCCCATTGCAGGAACAGGT
GACGTGAAGCTATCCATCAAAGATACGAAGGGAAGAGACAGAGTCATTACCCTGATCAACGTGCTGTACGCACCTGACCTCAAGTTTAACTTGCTCTCAG
TTCGTCAAGCTGTCGAAACGGACTACAAGATCAATTTCCCGAACGCCAAGAAATGCGTCCTGTTCTACGACCGTGGAACCAAGTTCGAAGCCAAGACTGG
CAATGGCACTCGCCTCTACCAATTCGAAGCTCGCCCGGTGAACACCGACCACGTAGCCCATGTGGCCAAATCTGGTACGTCCGATAATATTTTACTCTGG
CACAAACGAATGGGCCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCAGACGTTGTCACAGACATGGGGATGTCGAAATTCGACTCAAGCAAAG
ACTACTTTTGCTCCTCATGCACATACGCTAAAGCACATCGTAACCCATTCAATAAACGTACTGTTGAAAGGGCAAAATTCCCTCTTGAAAAGGTTCACAC
AGATATGGCTGAACCCCTTCCTGTGCCAACACTATCAGGATGTCAATATTTCTTGACCTTTATTGATGACTACTCGCGCTATATGTTTATCTACGTTATC
AGGCGCAAGTCAGACCTTTATGGCTGCTACGAGGACTTCAGAAAGAAAGCACAGAACATGTTTCGCGCTGATGTGGGTCACTTAGCATACGATGCTAATA
TGCACGATGAAGAAATCCGGAACCTCCAAAGTGACAACGCTCGTGAATATGAAAAACTCGGCAGAATTATCTTCGAAAAATATAACACCCACGCACAGTT
CACTAATGCGTACACACCACAACAGAATGGCGTGGCAGAGAGGCGTATGCGCACACTCCTTGAAAGAACGCGAGCTTTTCTAATTGACGGAGATCTTGAT
CAACTCCTTTGGGGCGAATGCATCACCCACGTCGCTGATCTCCTCAACATGACCCCGAGCTCGGTCACAAACAACGTTACTCCCCATGAAAAATGGTTCA
AAAAGAAACCATCAGCACACTACATTAAGGTTTTTGGCTGCACGGCATACGCTCACGTCCCGGAACTATACCGCAACAAACTCGAAAAACGGGCTAGAAA
ATGCATGTATCTCGGAATTCCATCCAACAAGAAGGGCTACAGGCTCTTAGATACGACAGAGAATCGCATCATTTACAGTCGTGATGTTACCTTCCGCGAA
CATGAATTCCCCACGCTGGATTTTCTCGATCTACAGAAATCAACAGACATACTTAGCCCTAAAACAGGCACTACAGTACCAGCACCCATTCAATTGCCCT
CACTGTCAGCAATGCGAAAACGCAATGCTAATGCACTTGCTGCTGAAGATACAGAACCAGCACCTAAGAAAGCAAAATCTCTCTTAGAATGCAGATGTAC
TGATCCAGTAACAACCTTGCTCAATGGTACCCTCGATCTAGAGGAACGCGAAACAAGTCGCAACGCCCTCCACACACTACTTGCTATCAGGCATATATCG
GAGCCAAAGACCTACAAGGCAGCCATGCAGCTGCCAGAAGCTCCTCACTGGAAAATAGCCGCACGATCTGAGTACAAGTCTCTCATGGACAATAAAACGT
GGATACTGACCAAGTTGCCCAATGGCAGGCGTGCATTGCAATGCAGGTGGGTATTTGTCGTCAAATACAAAGGCGACGGCACAATAGATCGCTACAAAGC
TCGCCTAGTTATTAAGGGTTTCCTCCAAAGATATGGAATTGACTATGATGAGATTTTCTCCCCTGTCATCCGCATGGAAGTCCTACGACTGATACTTACC
ATCGCTGCTTTATTGAATATGGAAATCCATCAGATGGACGTCAAAACCGCATTCTTAAATGGGCATCTAGATGAGGAAATATACATGGAACAACCTGAAG
GATTCTTTTGCCGAGGTAAAGAACACCTCGTCTGCAAACTGATGAAGAGTCTATATGGACTCAAACAAGCCCCTCGAGTCTGGTACTTGACACTGTGTGA
CTACTTAGCTACGATGAAGTTTCGCAAACTTACAAAAGACCAATGCGTCTTTGTCGGTGAAATTGACGGAAAAACATGTTACATTCTTGTCTACGTCGAT
GACCTTCTCATCATTGCACCTACAGTCGACATTGTCACATATATCAAGGACGCACTGAAACAGCGCTTCAAAATGTCCGATCTGGGCGAAGCCCAATACC
TCTTAGGGTGGTCCATTGTACGCGATCGAAAAAATCGCTCCATCTTCATACACCAAGAAAAATACGCTACCAAAGTCCTGGACCGCTTCTCCCATCTAAA
CTCATATCCAGTGGAAACACCCACTGATCTGAGTATCAAACTCTCTCTAGATATGTGCCCACAAACTCCTTTGGAACACGATGAGATGAAGGCGATCCCG
TACAGAGAGGCAGTCGGTAGCTTCATGTACCTGATGATGGGAACGAGACCAGACCTAGCCTATTTTCTACGAGAGGTCAGTCAATTTCTGGCTAATCCAG
GGAAACAACACTGGAATGCGGTTAAGAGAGGCCTTAGATACCTAAATGGTACACGTAACCTCGGCATTACCCTAGGAGGAAAAGAAAACCTACAGCAATA
TAACACAAAGCACTACCTCGCAGCCTTTGCAGATGCAGACTATGCTAACTGCGCCGACACACGTCGATCTGTAGGAGGATATATTACCTACATGTGTGGC
AGTCCAATCTCATGGCAGTCTAGAAAACACCACACAGTCGTGCTATCCACAACAGAAGCAGAATACATTGCACTATGCCACTGCATGCAGGAAGTCATCT
TCTTAAAACTCCTACTGATAGAGCTAAACCACAGTAGCCCACATGCCATCACTCTCTACGAGGACAACCAGAGCTGTATTAAACTCTCATATAACCCAGA
ACTTCATGGTAGAAGCAAACATATACATATTCGCTACTGCTTCGTACAAGAAAAGGTAGAGCGAAAAGAATTCGAGATAAAATACTGTAACACAAAGGAA
ATGGTGGCAGATATATTCACCAAGTCACTCGCAAAGCCGACTTTTCT