Description :
From Genome Similarity Track
Location :
Scaffold_67:55122- 57564
Sequence
2442 bases(100 bases per row)
TGTAGTGGGCCACGCCATTACATAAGTAGGTAGATTTATATTACAAAAGTAGGTGCAGCAGCACACGGCTAGCGTGTGCTGAACTGCCGTCATCCAATTG
GTTGATATATGGGGAGCCAGACCCATTATCACCCAATAAGGGTTTGACGTGTATTTGAGTGGTCAGGGCAAGCTGCCCTGGACCTAAATAAAAACAGAGT
TGATTTCCCTTCAGACTAAGCACTTGGTTTCACTATCGCGGAACTTGCACGCTTCCTCATTATTACGTGTAAGCTAGTAACGGACACTCTAGGCCCGTTA
CACCTGGTAGCACTTCGTAGTCCTTCCCATGACCAAGTTCACAATGAGCCAAGGCCTAAAGTCTGAAGCTTCAGGGTCAACCCTGGAGCATGCTGCTTTC
CCTCAGCTCACTCGTGTCGAGTGGGAAGCCTTTCACCGCCTTGCGGCGGTGTCCGGTGAGGCTGTGTCGCGTCGCTGCTGAGCTCAGCGACTCCCGATCA
ACAACGTCAAGCAGCTCAAGAGTTCATGGAACGCGAGCTCGCCGACGCGAATCGGCGAGCGACAACTCTCTCGCGTTCCTCGAGGATGATCGAGGCGCAA
GGAGCGAAAGTTAACTTCTTACTTTCCCGACTGGCCGGGAAAGCAAGGAGTGGGCACTCGGCAAACTGGTCGTAAACAACGATGCGTTCTCCACCCTGGA
GGCCCTCCAGAGTGATCTTCGTCTCGCCTTCGAGCCTCCACAAGACGAGTCCCGAGTGCGCGCAGAGTTCTTCGCTCTGCGACAAGGCAAGATGACCATG
CGCGACTACGTCCAGAAGACACGCCACCTCGCGTCCTGCATCGTCACCAATCCGATTGACATGGCATCTCAAGTCCACGTCTTCGTGTTCGGCATGCGTG
AAGGCATGACGCGATACTGTCTGACTCGAGCGGAACCCTCCTCACTCAAGGAGGCATTTGCTCTCGCACTTCGTAAAGACTACGTAGTGGCGGCGTCGTA
CGCGCGGGAAATGTCCGCGGAAGCTCAAGAGTCAGCTCCGGAGCCGATGGAGATCGACGCGATTGACGCGTCGAACAGCCGCCGTCGTGCAGTCCCTCGC
GCGAATGGTGGTCGTACCAGTCGATCCCTCACTTGCTTCCGCTGTCGGAAGGTTGGACATCGCGCGGCTGAGTGCGGCGCGCCCCACGCCAGTGCTCACG
CATACTGTCGATGCCTCTCCTACCGATCAGCCAAAAAAACGGTCAGGGCCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGTCCCCCGG
TGGCAACCCAACCTTCTAGCCCTCGCGTGCTACACGCACACTTCAATGCCACCACAGCGTCGGGCGACTCAAGACTGATCATCATCAGCCTCCATGTCGC
CGGCGCCCGACGTCCACTACGCGCGCTTGTGGACTTAGGAGCGACAAACAACTTCTTCCGTGAGTCGTGTTTGTCGACGCTACCCAGCGAAATCGCTGTC
CGCAACGGTCGCGGACAGGTTGAAGTCAAGCTTGCTGACGGAAAGCCGCGCCACGTCGCGCGGCGCGAGATTACGTTGCCGTACACTTTCGACGGCTTTC
GCAGCAATGACGACTTCCTCGTGATTGAGATGAACTACGCATTCGATTGCATCCTGGGCATCCCGTGGTTGTCACGGTATCAACCAGAGATTGACTGGTT
GGCCCGCTCGGTTAAACACCGCAGCGGTTTCGACGTGAGCGAGGTGTTCACCCACCTCCTGGTTGCCCAGAAGGACTGGCCCCACGTCACCGTCGTGGAC
CGGTCGTCCACGACGCAGGCTGGACACAGATTGAGCGATGGCCCTCTCTGCACGGCTTGCGCAGTGCTGTTGCACGAAGACTCCTCGGCGCGAGGCGAGG
GCAAGAACACGATGGCGGTCGAGCAGGGTCTCCCGCAATACGAGCAAGCGGTCGAGCATGGGTTCCCCGCGGCGCACCACAGCGGTCGAGCATGGGTTCC
CGCGGCGCACCACAGCGGTCGAGCATGAGTTCCCGCAGCACGATATGGCGGTCGAGCATGGGCTCCCGCAATGTAACACGGCGGTCGAGCAGTCGAGGCT
CCCGTCACCCGAGCCGGTGGTCGAGCAGTTGGAGCTCCCGCCGAACGACCACGCGGTCAAGCAGTGGCCCCCGCGTGTGACCGGCACAGTCGAGAGTGAG
CTTCAGTGCCTAGAGCGGGGTGATACATCGTCCAGCGAGAGCGATTCTTCCTCCTCGAGTACACACTCGAGGCGCCGGGCAAAGAAGTCGAAGCGCCGTC
ATTTGAAGCCACGACGTGAAACTGCACCGAGCGGCATCTCACAGACGGAGTCGGTCTGTGTCATTGAGCACGTGGACGACGGCATGGACCGTCAGCGCAC
CGTCGATCTTGTGTGTCCACCTCGCGACACTCAATCGATCAC