Description :
From Genome Similarity Track
Location :
scaffold_891:5512- 10184
Transcript NameFunction/comments
g10555.t1 reverse transcriptase
g10556.t1 reverse transcriptase

Sequence
4672 bases(100 bases per row)
GGGAAACGCGAACGACCAGTAGGCGCGGGGCGGCCTACTGAGGAAAACTAGGTTCTGTGGTGCCTCTGGAGGAGAGGGGGCGACAGGGCCTAGCCCCGAA
GGGAGCAACGCTCCCTGACACGAAACGTGTCTGCAAGCCGGGCTTGCTCGTCGTGAAGGCGACGGTGAAGGGCTTTGAGAAGCCGTGGACGGTATTGATC
GACTCAGGAGCGTCGGGTAACTATGCCCGGCGCTCCACGGTTGATGGGAGTCAGCTATATGCTAAGGCGCTGGAAGCGCATTCGCGTGACATCGTCACTG
TCCGTCTAGCGACGGGCACACGTGTTACGGTGCCCCGGGTCCCCGTGGATCTGGGGGTGAAGTTCCTAGACTTCGACATCGAACGCTGCTTGGTCTTGTA
CCTGGATTCCAGGTACGACCTCATCCTTGGTATGGCGTGGCTGGAGCGCCACGAGCCATGGATCGACTGGAAGTCGAAAACGTTAGGCGCAACGCGCTCT
CCTCCTAGTGGAGCATTGGCGAGTCATGAACCCATCTCCGCTAGGAAGCAGAAGCGCTATTGGCGCGAGCACTGGACCGAGGCGGTCAACATGCTGGGCA
TTGGTATGTCGGAACTGGTGGCTCTGCGTGTGTCAAGGACGAGAGTCCCGAGCAAGGCTCGCGGGCTGTAAGCGGAGCGGCACGTATACCGCTGAGCGGT
GCTCATCGTGAGCATGAGTCATCGCTGCATGTCAAGCACGACATGGTCGGCTGTACGCCGAGGCTTCCGGAGGCTAAGCCTCTCAAGGAAGGACGTGGGG
TGGCACGTAATCCACTGAGTGGGGTTGGTCAGCCTGACGACACCTCGCTGGGTGTCAGTCTAGACACCAAAGCTCACGCTGAGCTGAAGGAGGTGGCAAC
ACCTGGGATCGCTACGAGCGTTGATAGTCCGGCTTCACCGAAGCGGACGGTCTCCATGCGGAGACGGCAGCGGCGCCGAGCGCTTGCTGCACGACGCAAG
GCGTCAAAGGAGGTGCAGGAGACACCTGACGTGTCGAGCAAGGCAGCTCCACGTGATAGCGAGCAGCTATACACACTCGTTAATGGAGTGACTGGGGAGG
TTGACGGCGAAGTCACTCTCGAGAGTATGCCGGACTTGGCTGCTCTGTTGGAGCTGGACGAGATGTCTCTGGCCGAGTTTGGCGACACCGTGCAGGCAGG
TGACCTCGCGGAGGTGGTCGTAATACGACCTGAGGAAGAGCTGAACTCAACCTCGCTTTTAGATGAAGCCGTCCTTGAGGACACCAAGAAGGCGCTCAAC
GCGCGTAGTGGATCGGCGATCCTGAGGGACCCGTCGGATCCGTTCTATTCTTTGGTCAAGGAGTACCAGGATGTGGTCTCGAAGGACCCACCCTCGGGTC
TACCTCCGGACCGAGGTGTTCATCATGAGATTGACCTGGTTCTCGGAACCAAATACTGTGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGCGACGT
TATCGACCCCTTCTTCCGTGCGAAGCACGAGGCGGGTATGGTGCGTGAGAGCAAGTCTCCGCACTCTACGCCTACATTCTGTGTCAGAAAGCCGAACGGC
AAGTGGCGCATTGTTCATGCTTTTAACAAGCTGAACGCAGCCACGATCCCGGCGCAGACGTCTATTCCTCGGAAGGATGTTCTTCTGAACAACACGGTGG
GCTGTACGATGTACAGTGCCCTCGACTTGGTCGATGGATATTATCAGTTGCTCATGCGAGTACAAGATATACCGCTGACGGCGGTTAGTACTCCGAGCGG
TATGCTCTGGGAGTGGCTAGTGATGCCCCAAGGGCTATCGAACGCACCAGCGACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTAC
GCACAGACGTACTTTGACGATATTTTCGTCCACAGTCGTGCGGAGTACCGGGGATCGGATGTGGAGAACCACGTTGACTACTTGCGAGCGGTGCTCGAGT
GCATGCGCACGAACAAGCTGTATGCTAACGCAGACAAGTGCATCTTCGGTGCCGAAGAGATTCCCTTCTTAGGGTGCTTAATCGGGAAGCGTGGCGTTAG
GGCGGACCCCGCCAAGGTCAAGGCCATTGTGGGTTGGCCGGTTCCGATGAACCAGAAGGACTTAAGGAAGTGGTTGGGCCTGGCCAACTACTTGCACAAG
TACAGTGCTAACTATGCCGAGATGGCTAGGCCATTGCCGAATCTCCTAAGAAGGATCCTGAGTGGCGTTGAGGCTCTAGCGAGAGTGACGCCTTCGAGGC
GGTTAAGGAGAGCCTCCTTCATGCCCCTATTCTGACCCTGCCAGATCCTGATCGTCCTTTCAGTGTGGTCTGTGACGCGTCGGACTTTGCCATCGGCAGC
GCCCTGTTACAGGAGGACGCTGACGGGCGTGAACGCGTGATCGCGTTTGAGCCTCGCCAGCTGAAGGCTGCTGAGAAGAACTATCCCGTTCACGACAAGG
AGCTACTTGCCACGAAGTATGCTCTTGTCAAATTCGGGGTCCACCTGCTCGGCTCCAAGCCATTCGTGATCTACACGGATCATGCGTCACTACGCACTGC
GACGCAGTCGCCTCACCTGTCCCAGAGGATGGCCCGATGGCTCTCCTTCTTTGCGGAGTATAACTTCGAGGTGAAGTACAAGCCTGGCCGGCAGAATGCT
CTCGCCGATGCGCTGTCGCGTCGACCGGACTATGAGCTTGCTCATATCACGATGGTGACGTCGTCGTTGACAGATCAGATACGCAAACGCGAATGCTAAC
GACGGTTCGTGTGTAGCTTTGCTACGTGCTCTGGGTAGCAAGGAATACGAGGACTCTGACAGCAAACTGTCGGCACGCATGCGTGCGAGGCTTCATCGAT
ACACTCTCGATGGTGGCTTGCTGTATTACAGCACCGATCCTGAGGATTCTCCACGGGTGGTTGTCCCTCATGATGAGGATTCGAAGTACCGTATCCTCTA
TGACACCATTTGGCGGGCAACTAGGTCGGGAGAAGATCTACAGCTCTGTGAGCACTCACTACTGGTGGCCCAAGATGTATAAGTGGGCGAGAACATACGT
GCGCACGTGTGAGACGTGTCAGCGGGTGAAGCCATCCCCGCATGCGGCGGCGCCTCTGGCGAGTCTGTCTGTGCCCTTGGGGCTGTTGTAATCCATGAAT
ATGGACTTTGTGTTTGGCCTTCCGAAGGACTCTGATGGCAACACGGATGTGGTGGTCTTTGTTGACCGGCTGAGCAAGATGGCTCACCTGGCGGCGGTGC
CAGATACCATTGGTGGTAAAGCGACTGCGACAGTCTTTATGGACCGTGTCTTCCGACAACATGGACTCCCTGAGTCCATTGTCTCGGATCGAGACCCCCG
TTTCACGGGTAAGTTCTGGTCCTCAGTGTTCGAGGTGCTTGGTACCAAGCGGACATGTCCACTATGGATCATCCGCAGACCGACGGTCAGACGGAACGCG
TGAATCGCGTTGTGGAGGACATACTCCGAAGCATTTGCGCAGAAACGCCAAAGCGTTGGAGCGCTATGCTGCCCTTTGTGGAGTTTGCGTTGAATAACGC
GGTGCATGCCTTCACAGGCTTCACGCCGTTCTACGTCAATGGGTTGACGAACCCGCGTGTCCCTTTCACGCCTCCATTACGTGGTTCAGGGCTTGGGGGA
GAGAGAGAGAGATAGCCGAGCGGCTTGCTGATGTCAGCCCTCTCACTGTTCGTAAACAGGTGGGTGACTACTTGTCCACGCGTCTGAGTGTCCTTCGACA
CGTACGTGACGCTATGGCTGAGAGCCAAGACAAACAAAAGGAACATGCTGATGCTAAAGGCAGAGGCAATGTTGAAAATTATGAGGTCGGGGACCTGTTT
TTATTAAACGCTAAGAACCTACCTACACATGCAGTGTCTGCGGTCTTTAACACCAAGTTGCGTCCTCGCTTCATTGGACCTTTTAAGGTCGTGGCCAAGA
AGGGCCTCGCGTACACGCTTGACCTCCCAAAGAGGATGCGAACACACCCGGTGTTCTACGTGGGCTTGCTTAAGCCTTATCGGGACCCGGCTCAGGTGAG
CGCGTCGGCGCTGGCTCCGCGCGAGGCCAAGGGCCCGGAGGGGGGGGGCGTGGCTCTGGAGGCGCACGAGAAGATCGAGCTAGGCTCGTAGTTCCAAGAT
CGTCCGCTCCGCGGATTGGAGACCAGTCTCGACGCCTTCCAGGCGAGTCACACGTGACTCGAGATTGGCGACAGCCGTCTCCGCCGCTTGTAAGCGCTGA
CATTCTGCTCAATCTGGTCCGAGACCTCCCGTGGGAGCGTCCACCAGTCGAGGCGCTGCTCCACACGATCGATCTCATCGAAGATCCGGCCAATCTGGCC
AGCCGCATGGCGGTGATCGTCTTGTAGACGCTCCGCTCCACGCCTTGACGGAGATGCCTCATCGGCTCTCCGAAGGAGGATCTAGGTCGTCATCGTCCTC
CTCCTGCTTTGCTCGATGAGCATGGGAATCACCACTATCATGTGGAGCGGATTCTCGCCCGACGTCGTCATCAGGGGCATAACCAGTATCTGGTAAAGTG
GCGTGGCTATCCTCACTCTGAGAACTCATGGGAGTTTGAGGTGCCACTGCGGAAAGACTGCCCTGACGTCGT