Description :
From Genome Similarity Track
Location :
Scaffold_174:55111- 58537
Transcript NameFunction/comments
Hyaar_Emoy2811888hypothetical protein

Sequence
3426 bases(100 bases per row)
TCCGTAGTAGCTTCAAACGCAAGTGTCTGCCACTCTTGATATCGCCGTGACCCCACGGACACATACTCGGGTCATCGCGGTATTATATCCGCTGGTATCC
ATTGCCTGAATAGCGTCCCTTGTTGGATTATCACCTCTTGATCAGTCAGATTGGTCAGCCAAAGTTACGTGAGCCTTCCGGGTCCAGTTGTAGCCGTAGG
TTTCCAGCGTGAGTGGCGTGTTAGCCAAAATTCCGACTGAAGTGGTCTTCGATTAACGTTGACTTCCACGGAGTTACCCAACGGGATCGCTAAGTACTTC
TCATCTGCAGCTATTCGTTGTACCTTAGCCCCATACGGTGGTCTTCTACCTTCCAGTCGAATTCTAACTTCGTCCAGCAAACAAACTGTCCCGTACGCCA
GATCAGGCGTATTCTGGCCAGTACCATGAAATCCATTCCTAGAATTGCTTCTTGTCCCTCTTGGTCACCGACCCATACATCAAAGTAGAAGACTTGAGAC
CCATTCAGCGTAATATTCACCTTCGTGCGTCCTTCAGCCATGTATAAATTGCCTCCAATACCCACACATTCTTGCTTCTGACTCTCACCAATGACACAGC
CAGCCTTACGAGCAAAGGTGGTGTCGATGATCGAGAATTCTGCTCTCGAATCAAACAATAGGATGGCCTTCTCATTGTTATTTTTCCCCAGCCTTGGCCT
CTCCGAACTACTTGTTTGGAGTATGATACTTCCAACAACCACGTGATTCTCCAGGAGACAACTTAAGCTCCATCTTGGTGGGTGATCGTGCGTTTTCGTC
CGGTCGCCGCGGACTTGCAATTGAAGAAAACAACTAGAATCCAAACCACATGCACTGAAAGTCCGGCCGGTCAGGATATTACCACTGTTATCAACCCCTT
TTCTCTCAATGAATGCATATATGCATACCCTAGAACGCTCGGCTCGTACCAGATTCTGTACTGGCAAGCGTCCTAGTTTATATCTTCTCCGCGTCAGGAG
GAAGCATTCCGGCATGTTTGGTCGGCACGTACCACTTGCGGAGCATGTTTTAATACATTTTCATCGGGCATTTGTCTCCGTCGTGTACTTCTCCACACGC
TGCGCACCCATAGAAACACTTGTCAGAGGGGTGACCTCGGCGTCTGCTTTTCTGGCAGGTCAACCGTTTCCAGCATCCACGATCACCATGTCTTTTCGAC
CCATAATGAGTGCACGACTTGTGTCCTCCTGCACCATCCTGATCACGCTCCCGGTCGCCCAGTCTTGGCTTGGTCGGACGTTCATTTGCTCGATTCATCG
TTTGGTCGGCTGCCGTGGTGACGTAAACTCGTCGATGTTCTTCGTCTGAGTCTGAACCGATTATATTTGATTCTGAAGAACTGCTATCGCCCCCCACGTG
GATTGCAAGCACGGCTCGAGCCGGTTTGGATGGACTTGGTGTGTATGGTGATGCTGATCGTGAGCGGAACTTGCTTGAACTGGCCGCGAGGTTGCATTTG
CGTTTCTGACCGTCCAGTGTTTCTATATAGTGTTCAACATGTTCTGGGTGATCAACGATATTCCTGTCTATCCCATGAATCTTCGCTCGCATCCCAGCAA
CGTTCAATCGGTAGAGATACTCTAACGGAGTTTCATCGGCACGCTTGAAGGCATGATAATACCGGCGACCAGCCGAGACGCCGCGTCCACAGTATTGTAA
GAGGAAGCTCTCGAGTAAGTATTTCCACTTATTACGTGTCTATCGACTCAAAAAGGAGTACCAGTTTCGTACTGGAACCGTTAGAAAATAGACAAAAAAA
CAGACATTTCAACGATTCGGGGGCTTGGTCATGCAAGAAGGCTGACCTGACTTTTGTACCGTACCCATCCTTGGGCGCGGTCAATGTCGCGATTGCAGCC
TGAATATTTCTTTAACTCGGCAATGGTAGACATGCAAATCCGTTGCGCAGAAAGACCTTCTCCTGTTTTGGCTTCAGTAGTAGCCAAGTGGGGTCGCCGG
AGGTCATCGATATCGAGATCATCAGGGTCGAATGCGTTTCCGTGGCTGTCATACGAGTCAGCTGATTCCATGTCGGTGTCCGGTATACACTCCCCGAACA
CATTGTGGGTGGGGGTGGGACGATCGGTCAGCATGCTACGGGGCGGTCGACGGTGCTGGTCCTGTAAGAACTTTTCCTTGGCTTTTGCAAAGTAGATTGG
CATCTGATCCGATTCATCCATAGCAGAGATAGTGCGTAGTGATTGAACACATCACCCTGGTGGTTGGAGATGTATTCTCGTGGTGGTCACGCAAAAGTGC
TGCTTCGGAAGGTCCCAACGAAATTTGTTTGATCTCCATTTCATCTCTTTCCTCTGCATCCGACTCCGTAGAGGCGTAATACGACGACCCAGCCGGAGAA
TGTTCTTTTTGGACGTCGACGGTGGTCGTGAGTTCGCGATCAGCGATGTCATAATTACCGGTTAGCGGGACCAGTGTCTTGAACAGTGATCGACTGGTCG
TAGTCACCTGATCCAGGTCGCAGTCAATCGACCTGGGCATCTAACGCCCCCGGTACAAAGCCTGCTCCTTGTAGTAACTGAATGATACGATTACCGCTTC
CATCTTGCTGGTAGCAGCTCGTGGTCCCATTGAAAATCCTTGGATTGGTCCGATCAACTCCGGTTTCAAGGTTGTGAGCACCGGATCTGTGCATAGCAAA
GTTTGAAGCTGGGTCCAGTACAAACGACGTTGTAGCTGATTCATCTTCCAAACTCGCAGCTTCACCTCTGCTGCATCCATCGTTGACTGATCGTTACCCT
CGGAGTCAGGCGCTTGTAGCTTTAAAACGTAGCATTTGTTCTGTTTTCTTTGTATATGGTTTTGTTTTTAGATGAAACATGTCCTGCTTTGGCTGGACGT
GTTCCATTTAGCGGGTCATACTTTGCAGCACGATCCGCGGTGCTCCCCGAAGAGACCCCAGGAGGGAATGGAGGTTTTCCCCAAGATCACCTGAGTGATC
TTCGTCTTCAATATCGGTTCACCCGAGCCCGTTCAAAAACTCTAACGAACCGAGGACCCTTGATGACCACTGTCTGCAACGATCCCTTCTTTGCCGACAC
TTTCATCCCCAGTTCAAACTTGACATCTTAGCTCTGGGATTCACGGTGAAATCACGAGTCACCATAAGATCCGGGCACGCGCCCCATTGTGGTAAAGTAG
GATTCGCTCATTTTGCGAAGCGATCTCAACTCTCCACTTTCGCCGGAAGACCGACTAACGGATGGGGTACTCCGAACCGTGTGTCTTATCTTGTTCCTTC
TTACCTTTTTTACCCGTAGGCGGGCGGGTTGCACTCTTCTAGGTGGCTTGAGGTCGATGTCTGTCTTGACCGAGTTGGGAATAGGTGGGTGTGGTCACGT
GGGAATTCTTCACACGACCAACGGTT