Description :
From Genome Similarity Track
Location :
scaffold_1052:5511- 7759
Transcript NameFunction/comments
g10905.t1 hypothetical protein PHYSODRAFT_253474

Sequence
2248 bases(100 bases per row)
CACTTCTCGCAGGGCAATCGGCTCCAGCAATCGAGATCCGTGTGTTTCCTGGATTCACAATGCGAGCACCGACCTCGATCCTGGTGATCGCGATCAGAGG
GGGTCCGGTAATTGGGGATCCGGCCTCGATCTTACGTATTCGGGCGAGATCGTGCCTGATCCGGCGGGTGGGACCCACCCCCAGCACCGGTCGACTGGTC
TTCAACCGCGGCTAGGTAGATCCTTCGTAGATCTCCTTCAGAGTCGGACCCACCTGATCCGGACACCCCTTCTGTCTCCGTACTCTGATCTTGGGCCTGG
ATCGCACGAACTACAGCTCTGGCGGGCACCGTGGGCGTGCTCGATGGAGTCTTCTGTCGATACTTCGATTCGAACGTGCTGTCTGCTCTTGAGCCCGAAA
CATTTCCTCCAGACCGTCGACGTCGTTTAGTCGAAGCAAGGTCAGGGGATCTGCCAGCTCGGGATCACCTAAAGTCTCGATGAAGTGATCGACGTGTTCC
CGGCGGGCCTTGAGGTTTCCGTCCTTGGTCTTGAGTTTGGCTCGCAAGGCAGTCACATTCAGACGATAAAGGTAATCGAGAGGGGTTTCTTCGGACTGTT
TGCGTGCTTGGTAGTATTACCATGCCACTGATATCAAATCCCGTAATATTGGGTCTAGAAACTGTCCAGCAGATCTGCCGACCTGATCTTGGTCGTTCCA
CTCAGCTGTTGATACCAATTCTTCGCCGGACGGATCATGAGATCTGCGAAGATGAGGCATTTCTCCTCTTCGGCGGCTTGATCTCTCTGGAACGCGGACT
TGACCTTGCTGATCCAGGCCTGGGCGCTATCTTCGTCGAGACCTTTGCCGGCGGACTCCTTTAGACCCGAGGTCGCCGAGACCCGGACTCTCTGGATCAT
TGATGATCCTTTTGGCCTGATCGCGGCTCTGGTCACAGCCGCCTGGTCTCAGTTGCTCTTGTGGGACTCGAGATTCCAAGATCATCCGGGCCATACTCCC
ACGAGTGCTTGATCCGGGGTCCCGACTGACTCCATATGCGCTCCCATGCACTTTGGGAATCTGAGTGATCTAGGAGTAGCTAGAGTTTGATCCTCTAGGA
ACCGGTTCATCGCCACTTGGAAGTATTCATCAAACTTGCTGCTGTCGAATTGGTTGTCGGAGTAGCTGGATCTGCCGTGATCTGGCGATCTTCCCGTTGA
TCGGGTGGTCTAGCGACTGACTTCAACCCAGCTGGGCGTTGATCTTGCTTCCTCGTGCGTGATCTCGGAGGGTTGGCTCCGGAGGGGCCCAGCGCCATTC
TTTGCGGTCCTCGGGAGCTATCCGAGTCAGACTGACGCATAATGCTAAGAGCCATTTTGATAGCCCGGATCCGGCGTCTGCGAGCGTTCACCTACCAAGA
TCTTGAGGGCACCGAAGAGCTCCCGAGTCGCGTACCGAATTGCAGCAAGATCCATGTCAAACAGGGAGTTCGAATCGAATTCTTCTGCCACCTGACCAGC
TTCTTGGAGTAGATCCAGCAAGATTTCCACCGCACTTAGGCGATCCGTGCCGATTCGGGGGTTCGACACTGGACCTGTCAGATCAACGATCTGGCGTCCC
TGTACAATCGCAAGTACGGGATCCTGTAGCAGGATCTCGCTCAACACCTTTCGGTAGTATGCCTGCTTGATCGTGTCCTTGATGGCGGTCGATCTCGACC
TGATTACATCTTCGGTTTCCGAATATGGCGCCCTTAGCTTTGTCCGGGTAGCCTTGATCTTCTTCTTCGTCGATCTCGGAACAACCGTGGACCTTGTGAG
CGGATTCCGATTCTCATCGCGATCGCCCCCGAAGGGGCCTTGGGAGGCATTCGAAGCTGTTCTTCGAGATCTGGATCGCGATCCAGGTCTGCCTCGTGTC
TGTCAACAGAGATCCTTCCAGAGCTCTGTTGAACCGTGGACCTTGCTATATTTAGCGGTGGCTTCGCCGATCCAACATCCGACGGCACTTCTTCCCCTTG
TTCAACTTTCACCTTGACTTCTTCTCGGGGCTCACGGTGGTATCTGAAGTCACCAGAAGATCCGGGCACGCGCACCGTTGTCGTGGAGCGAGATCGGCCA
AGATCGAGTTGAGGCAGTCTCGATACAACTAGCCCAGAAACCGACTAACGGAGGGGTCCCCCGATGATCCGTGATCTAGCTGTGTGTAGTATTCACCTTG
TGTACCCGTCGGTAGGCGGGTTTCGCTCTTCCAGGTGGCTTCTAAAGA