Description :
From Genome Similarity Track
Location :
Scaffold_4:551049- 552086
Transcript NameFunction/comments
Physo_155446GlimmerM protein 276

Sequence
1037 bases(100 bases per row)
AAGCCATGCTGTGCGCATTTCACAGTAGCAACGTCGCACGCAGTCTTCAGCACAAGCTGGAGGGGTACATTGCCACGCGATAAGCCCGCAAGACTGGCCC
CAATAAACGAGTCGCCCGCTCCATTGGACTCCACCACGCGATCGAGCTGAGCAGTAGGGATATGATGCCGCGTTGTCCCGATCATCTCCATATAGTAGAC
GCCTTCCGAGCCCCAAGGACAGATGAACGCCTTCACCCACTGGCTCCAGTATTCACCCCACTGCTGGCGTTGAATCCGATCGAAAAACTCCTGTGCGCTT
CCAATGTTGATGTTGTCCCGAAGGTAATCCTTGGACATGAACACGTAGTCCGCAAGTGATGCCAGTCTGCCGATTCACACACCAACACAGGTACCAGTCA
AATAAATCCTCAAACGCGCCGGTTAAATCACTGTTCTTACGTCTTTGCCAGAGTCCACGGGTATCTCGGGAACTCGATCTCGACCGAAATTTTGGCTTGC
GGTGCCTTCTCTCGAACGTGCATCATCATCTGCCTCGCAGACTCCATGTTGCGTCCCTCAAAGTGGAACCACACAGGTGCGTCCGCATCCTGTCGAATCT
CGGTAAAATACCGCTCCACCTGCTTCTTGAAAGCTTCCACGCCCAGCTCAGCGATTGTGCGCGAGTGCACAATTGTCCGCGAACCTGTCGCCCGACTTGA
CAAAATGTACTACAGTAAACACAAAAAGTAAAAGGTCAGAAGACTGCAAAAGTCGTCGGAGTTCTCGTCTTGGGGACTCACCGACAAGGGCATGCTGCCT
TCCGTCTCAATGACGGCCAGTGAGCAGTCGACATTAAAGCTCGCTAGATCATCGTGGATGAAGGCGGCGGCGCTGTCTTTAGCCGGGTCAGTCGAAGTGC
TCAACCATCGACAGCGACCCCCAAGTTGAGAACAAATAACCTGCACACAGAAATCAGTAAAACTAGGCACTTTACTACTATTCCTCACGGACTGAAAAAC
AATTATTGTACCAATGCGCTCGCAGCATTCCCGCCTC