Description :
From Genome Similarity Track
Location :
Scaffold_1536:551- 6376
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1536-snap-gene-0.1Adenylate kinase domain-containing protein 1

Sequence
5825 bases(100 bases per row)
GTTTTCAGGATCAGCGCCAAGTAGAAGCACGCAGACGCCCCCACACTCGCCTGCAGGAATTTTGGACGCTCACTGCCGAGCACGAGCAGCGACTCGTTCA
GCACGGCTGAGAGCTCTTGCTCGAGCTTCCCGGGAAAGCTCTTCGCCAGCGCAGTCGACAGTTGCGGTGGGAGCTTGACCGGGAGCTTCTGGCTCGCGTA
GAGCGCTGGTTGAGCGAGGAACCTGCGGCGCATCTCCTCCGAGGCGAAGAAGTAGACCTTGTGCAGGTACGACGACCGATAGAACACCTGTCCTTTGACG
ATCGCAGTCCAGTCCTTCGCACCGGCGCCCATCTTGAACGTCACGGGACAGTACCCTTTGAGCTCCGGGAACTCGCAGTCCGCGACGGAGATCAGACTCA
GTAGCGAGGCGTCGAGTGGTGCTTTCTGGACCAAAGCGCGAGCCTCTTCTTCCTGCTCTGGGCCAATAAAATCCATGGGATTCTCCATGAACTGCTGGGT
ATTCAGAGCATTCGCCATCCAGTAGCATTGATATCCAAACTGGACGCAGTGCTGGCGATCAGTAGCCCAAGAGCTGGAATACCGCGAAGAGCTCAGCTCA
ACAGTACAGAAATGCTGAAACACTGGGTGGCTCTGGAGCTTGAGGGTGCCAATACGCCGCACAACACCATCGAGTCGCGCGGTTCGACCCGCAACGAGAT
CTTTCCGGTACGCGCGCATACTGACAATGTGCGCGTCGAGACGCTCTTGCGCTTGCGCTAGCGCGTTCCAGAGCGAGGTCTGCGTCGCGCTGATCTGCTG
CACGTGGAAACTTCCGTACTGGGTACTCCAGAGCGTTAGCAGATCCAGTCGTTGTCGCTGCCAGACGGCGAACCGCTGCACGAGCAGATCTCGAGCCGCA
GCGAGCTCCACGCGCTTGATGTACTGGACTTCTGGGTCATTTGCACCGCCAGGTTCACAGTTGACAGGGCACTTGGCCAGTTGCTTCTTCTTGCGCTTCC
AAATGGTCTGGAAATTGCCATCGAGGATGAACAAAAGCCCCGGATCGACCGCCGCCATGGCCGTATCCTCCTTGAATCGCTGAAGATCTTCTGGTGTCTG
CAGGAAATCGTCGAGCACCCAGCCGTTCAGCTGGCATTCTGAAGACTGCAAGCGCGCCACAATGGCTTCATCGACCGTTTTCGCGTCTGGGATCGCGCCT
GCAGCTTGAGAAACACGAAGACGCTTGCTGAGCGATGTGGCGCCGTGGCATTGCAATACCCAGTCGATCGCAGCACGTGGTGAGACGTACACGAGTCTGT
ATTTCAGCGCAAGTTCTTTAGCGAATCTGGTTTTCCCCACAAGCGGTGCCCCTGTGACGCAGCAAGCGGGTTGGTAACCAGGAGCTGCAGAGGGTGCGTG
GTGGCTGATGTACTTGGCGGGATTGCCTACGAACTCGGTGAGTGCGTCCTTGTCCCGTGGGAAGTACAGTCGCCCTCGGTACTGTACGGCTCCGGTGTTT
TCGAAAGTGGTGGTGGTGGTTTTTGCTGTACCAGTCACGGGACAAACCGTGCCGTGCTTACCTACCACCAGCTCTCCAGTATCAAGACCACGCATCAGAG
TGCCTCGCTCGATAATCTCACAGTGGTCAAAGAGCGAGTCCTTGCGCTTCATTAGGGTATCAATTTCAGCCGAGATCTTGTTCACACTCTGTCGAAAAGA
CCCCGAGACGTCGATGCCTCCTGATGTTGTTGAAGTCGCGATAGTAATGCCGCGAGCTCGAAATGCGTCTATAGCCGCTGTGAGCGCTTCCTGGTCTACC
TGGAACTGCTCCTGGAGCCGCTGGATCTCTTCTGCTTCGGCTTCCTCAAAGTTGAACTCGGGCTCGCCATCATCTTCTTCCTCAATTACTTCACTGTCGT
CTCCTGATGCTGGACGACGCGCCTTGAGCTTCGTTCTTCGTTCAGGCAGGCTTGCTTTCCAGAGCTTGAGCTGATTCCTCACGGCTTGCTCCTTCGTCAG
ACTCAAAGGAGCGACTAGGACCGGGAACAGATCTTGCTGGAAGCAAATTTGAAGCAGCTCTGCCGACGGTAACCGAGAATCGTCAGCGCCGAGGCCTCCG
AGTACGATACAAGCGGGTCTTGGTGTGCCGCTTTGGTTCTGAGTATTGATCCTTTGGGATTTCTCGACAGATGACTGGAGATCCTTCTTAAGCTCTTCAA
CGTACAAATCAAGCGAGGAGCGCTGGGCTTCCTCGCTCTTGAGGGACTCGGTTCGCAATCGCTTCTCCAGTTGCTGGTTTGTGTGCTCCAGGTCCACGTC
TACAATCGAATACCCGCATTTGGCAGCATTGGCAAGAGCCTCAACGCCCTTTGATAGATGTACTACCCCAGAGCCCCGAACGCCCAATAACACAATCGTA
GGTACCAGCGAAGCCGTCGCGTTGTAGGAAGTTGGGAGATACTTGAGAGGATTTCGCTCGAAAGCGTCCTGTTCGCGCTTCCCAGCAAAACTGTAATACT
TAAAATTGAAAGCGGCGACAAACTCGGGCAGCCCAGGGATGAGAATCTGCTTTTCGAGCCAGGAAATAGGGCAAAACTGGTTTGTCTCGCCCTTTTCAGC
AGTTGGGGCGGTGGGTTTGGTGGCTCCTTCTTCGTCTTCAGCTTCATCTTCGCTGGTAGGTGCGAGTGCGAACGCATTCTCCACGTCTTCTGCGATGATG
TATCCATCTTCCACACGGTCAACACGAGGCGCGAGCGGGTCCAGTTGGCGTCGCAATGCAGCGACAGTGTCGTTGATGTCCTCATACAATGCGCTCGTCT
TGACAGCCACGCCTAGCTCTTTCATTATATCGCTTGCTGCACCAAAAGAAACCTGGAGCTGCTGGTGTTTCAGGTTCACGATCCCACCGCCACCTGTCGT
TTGATAGCTCTTGGATTGCTCATCCAGTAGCTCTTGGGTCGGATCTAGGAGAACGACCATCTCAGGGAGACATTCGCTCTCCTTCAATGCTGCGATGGTC
TCGCTTGTAAACAGAAGGTTACTGAGGATCCATGATGATGAAGTACTATGAAGGATGGCGCCTGCAACAAGCTCAGCTGCGCGCGCTCCTGCAAGCCTCT
TGCCCTCCATTAGCTCCATTTGCACAGCCATGGGGGTGCGCTTTGCGAGGACCTCGACTGCATCGAAAGCGGGCAGCCCCAGCGCACTTGCGATCGTAGC
GAGTGGACTCTCGGATCCTCCTTCTTTAGTGGCCGACAAAGTTGAGTTGCTGCTGCTCACAAGCCAAATCTGATCGAAAGGCTTGGCTTGTGGTGTCTTG
CGGAGGTATTGCAGTGGATGGGCACGGAAAGCGTCTCGAGCCTCTAGCGTCGCTGTCAAGTAGACGCGGCCTGAGAGACACACTGCGAGCGCAGGGTCTC
CGAGCACGAGTCCGTTCTCAGCTCTTGACGACACGGGGCAGAACTCTTTCCACCTCGAGAGCCGTCGCTTACCATTTCTTGCTGATGGTAGTAGGCACCA
CTGTCCTTCTATCGGCAGTTCACTCCAGTCGCCATACAGGAGCCATCGGATCTGATCCGCTCGACCAATTGAAATGATCTCTTCAGGGAGAGCAATGGGC
ACTACTTGCCTTGAGACATTGGTTCGTGAGATCCCAAACGAGTTCTACGCATAACAGAGACACAATACAGTAAATATCATACAAGGTCACATCGCAAAAC
GAACGACCACACAAAGACAAACTTACACCGGTGATGGCTCGAACGCAGTGGTCCAGGATCACACACAGCGACTGCGACGCCAGGATGTGGATGACATGGT
ATCGCTGCTTGGGGTTATTGATCGACGCTACTGGCAACGCTGCGATGCGCTCCTCGACGCGACTCGTGTAGTCTCTGTACCGGTCTCGAAAGCTCTCCAT
GAACAGCGAGCGGATGGGCAACGTGGGCTCATCGGGCGGTTCAATCTGGTTCCTCTCTGCTTGGGTCGGTTCTGGTGGCAGGCTCTCTGGTTCGTCACCT
TCTGGGGTTTCAGCAGCATCGCCCTCACCACTTGCCTCTTCACCAGGCTCACTGGCATCTGAATCTTCAGGATCTTCCGAACCGGCTTTAGCTTTGGTTA
CCGAATCATTAGTATCACTAGGTAGTGATGCATTCTCCTCTTGTGGTGAACGCACAAAGTCCGCAAAGCCCTGAGCTTCGATACTCGCAGTATCTCCGCT
CAGAACCGTTCTCTCGCGCGCCGAGTACACACATCTCGTCCTTGGGGCGATCGCGAATTGTTGCACCTGCTGCTGGATGTCGTCCTTTGCAGCGGACAGG
ACCACCAAGTAATCGGTTCCAATCACTTCTTCAATCTCATCTGGATAGACGTCGTCCATCACCACGCCCACGCCCTCCAGCAGCGACTTTTTCACATAAA
ACACGAAGATCTCGAGGCATTTTGCGCGAGAGAGTGTGTTTCCAGACAACAGTGCGTCCAGATCTGCGTCCGAGAAGACCAGATCTTCTTCGTGAACCGG
CTCAGGTTGTGACGGTGATGACAAAACCTCATCAATCTTCGGTGAGTCACCACTTGATCCAGCCAGAGTGTCCTCTGCTAAGGTATCTCCTTCATCGGTT
GGCTCAGAATATCCATTGGCTTGCTCGCTATCAGCAGAACCTGAACTATTGCGCTCTTGGCTTGCTGCTTCCTCCATGGCCAGCGCCGCAGCTCGCGCTC
TCTTTCTGTGAACCGCATCGTCCATCGCACTTCCAATAGAGAAGTAGCGCTGCTTCAACTTGTCTGCGAGCATCCTGGACACGCGCGTCTTGCCGCAATG
CGGCGGCCCCACGACCGCGACTCGGAGCGCTGGGAACTGCTCGAGCGACTGGATCGTGGCAATCGCGTCGTCCCAGGCGTCCTCGCTCTCCTTATTGAGG
GCCCGCGAGGTGATCGTCGGCGCGGAGGCGGCAGCCAAAGCCGCATTATAGGCAGCGCTAGTCGTGCTGGCGCTGGCGAAGAGCTCATGGTCTTCCGCGT
TTTCATTGAGTGCGCTGCTGTTGTTGCCGTTGGACTCTGCAAATAGCGCCGAGAACTTGCGGGAGAGCGCGAACTTGCGCGGATTGTAGCACAAGAGCAG
CTGTTTGAGCGACATTTGCTGCGAGTTGGGCGGCGCGAGCCCGCTGATCGTCTTGAGCTGCTCGTTGCCTGGCGGCATCTTCTGCAGGAACGCGCCACGG
ATCTTGGTCACGTCTCTGAGCGGTTTGAGCGTGTATGAGGCAGCTTCGTAGAGCTGCGGTGTAGACAGCGACGGCTTGAGCGTCAAGTTAACGGGATCAT
CGCCGTCATGAGCTGGACCTTTGCCTTCTTCACCCCCATCATCATCATCATCATCGCCAAGAAGCTGCGCGTCCGCCATTGCGATACACTCACGCAACTC
GAGGAAGAATGACACATACATGGACTGCTCGCTCTCCACGGGAAGCACGAGCTCCGCGATCTGCATGATGGCTTCTCGAAACAGCTCCAGCGTCATCGCA
CCCTGACCGCCTGCAGCTCCATTGCCACAGCCTTCGGTGTCGTACAGCCAATCTCGGTGCGCGATCGCCGTCGCGCCGTCATTGTTGAGTGACTGCAGCA
GCGCTTTGGCCACGCGCGCAAAGAACTCGTTGTAGCGCGACGCCGAGAGCCGTGCGTCCTGCTTCGCCTTGGCGAGGTCCCAGAAGAGCGCGATGTGCCG
CGTGACGTGCTCATGACTCAAGATCTGCGCGCGCCGAGCGAGCCAGAGTCTGAGCAGGTTGGCCTGGCCGTCGCCCACGCCGTTCTCGTACTCTTCCTCA
GGAAAGAGGAAGTGGCGGCGCATTG