Description :
From Genome Similarity Track
Location :
Scaffold_3:550796- 553145
Sequence
2349 bases(100 bases per row)
GGTGTACTACGATCCACCCTCTGTTCTACCTCCAGATAGAGGTATCCGTCATGAAATTGACGTAGTTCCTGGGACTAAATACTGTGTCACACGACTGTGG
CCCTTGCCTAAGGAACAATGTGATGTCATTGATGACTTCTTCCGTGCTAAGCATGAGGCAGGAATGGTTCGTGAGAGTAAAATCCACATTCGACACCGAC
ATTTTGTGTCAAAAAGCTGAACGGCAAGTGGCGTATTGTACATGTTTATAACAAGCTTAATGCGGCTACTACTCCGGCACAGACCCCTATTACTCCAAAG
GATGTTCTTCAAACCAACATGGTTGGTTTTACTATGTATAGCGCACTCGAGTTGGTCGATGGATATTATCAATTGCTCATGCGAGCTAGTGAAATTCCAC
TTACAGCGGTTAGTACTCCGAGTGGTATGCCATGGGAATGGCTGGTGATACCCCAAGGACTGTCTAATGCTCCAGCAACATTTAATCGTCTGGTAACGCA
ACGTTTCCGTCCACATCGGGATTATCCACAGACGTATTTTGATGACATTTTTGTCCATAGTCGTGCCGAACAAGGTTGGTCTGAAAACCACATCGATCAT
TTGCGAGCCGTGCTCGAGTGCATGCGCACTAATAAATTGTACGCCAACGCGTCTAAATGCATTTTTGGTGCGGAAGAGATCCCATTTTTGGGCTGTTTCA
TTGTCAAGCGCGGCCCTTGAGCGGATCTTGCTAAGTTCAAGGCTATAGTGGACTGGCCGATTCCTAAGGATCAAAAGAACTTGCGTAAGTGGCTTGGCCT
TGCCAATTACTTACACAAATACAGTGAAAATTACGCTGATATGGCTCGTTCATTAACTGATCTCCTTCAGAAGGACACAGATTGGCGCCGGGACAACACT
CATGCCGATGCATTTCGGGCAATAAAGGATAGTCTCCTCCATGATCCCATTTTAGTATTGCCAAAATATTGAGTACCCTTTTAGTGTTGTCTGCGATGCA
TCCGATTTTGCTATAGGCAACGCCTTGTTACAAATAGATGCTGAAGGCCTCGAGCTAGTGATCGCATGTGAATCTCGTCAGCTGAAAGCTGCTGAAAAGA
ACTATCCAGTTCACGACAAGGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGATCCAAGCCATTCGTCGTCTATACGGA
TCATGCGTCATTGCGCACGGCGACACAGTCGCCTTACCTCTCTCAGATAATGGCTCGGTGGCTTTACTTCTTTGCGGAATATAACTCCGAGGTGAAGTAT
AAGCCAGGCAAACACAATGTGTTGGAAGATGCTCTCTCTCGCCGATCTGAGTATGAGCTTGCTCATGTCACGACGTTGTCGTCTCCTATTTAGAAGTTAA
TTCTTGTAACATATTCACGGGATTCTCAGTGTGTGGCATTCTTTCATGCCCTTGGGAGTGAGGAATACAAAGACTCGGACAGTCAGTTCTCGGCATGCTT
GCGCGCCAGCCTAGATCGATATTCCAACGATAATGGCCTTTTGTGCTATTGCACAGATGTAGCGAAATACCGCTCGCATTGTTGTACCTCACAATGAGGA
TCTAAAATATCGAATCCTCTTTGAGGCCACGATACTACCCTCAGTGGGCATTTGGGACTGGAAAAGACCTATAGATATGTGAGTCAACACTACTGGTGGC
CCAAAATCTACAAGTGGGTGGGCACATACGTGCGTACATGCGAAATGTGCCAGCGGGTCGAACCCTCAGCACATTGGACTGCTCCACTCGCCAGTTTACC
TGTGCCCACGGGGTGTTGAGAGTCCATCAGTATGGATTTTGGGTTTGGTCTTCCCAAAGAATGTGATGGCAATACGGGTATTGTGGTCTTTGTTGACCGT
TTATGCAAGATGGCTCACTTGGCGGCGGTGCCGGATTCCATCGATGGCAACGGTACATCTATGCTGTTTATCGATCGTGTGTTTCTTCAACACGGGTTGC
CACTGGCAATCATCTCTGATCGTGACCCTCGCTTCACAGGCAAATTTTGGACTTCCGTCGTCAAGATGCTTGGCACGCGATTGGACATGTCCACAGCGGA
TAATCCGCAGACCGACGGTCGGACTGAGCAATTTAATCGCGTCATTGGCGACGTTCTTCGCAGTGTTTGTGCTGAGTCGCCTAAGATTTTTTTTTATTTG
GATCTCGATACTCCCTGTCATGAAGTTTGCCTTGAACAACGCTGTTCATGCCTCGACTGGCTTTAATCCCTTCTATGTGAATAGCCTCATTCAAACCCGC
GTTCCGATCACATTACTACTCCGTGGTTCTGTGCTTGGTGGAGGAGAGT