Description :
From Genome Similarity Track
Location :
Scaffold_74:55073- 82851
Transcript NameFunction/comments
Phymu_g3517hypothetical protein
Phymu_g3518hypothetical protein PHYSODRAFT_466927
Phymu_g3519hypothetical protein
Phymu_g3520hypothetical protein PHYSODRAFT_353505
Phymu_g3521conserved hypothetical protein

Sequence
27778 bases(100 bases per row)
CCATGGGGCAGCAGGTCTCACTTCCGTCGGCGGTGACGCAGCCGCCGGGCGAGCGCACGCAGCTGCGACCTCTGCAGGCGCCCTACGTACCGCTCTGCGA
TGTCCTCAAAGCTGGCGACGCGGGCGTGGCGGTGGGTTCCGCTCCCGATGAGGCAAAAGACGCAATGGATAAAATCCTCGAGTTCGGCGCGGCGCTGCGC
TGCCTTCCTAAAGGTGAAACATACACCGTTTATTATGTAAACAGAACAACCATCTCACTTCTGTGTTGCTTGTACAGAGAGCGAAGTACCGGGACGGTTG
CAGACGCGCAGTCCGGAACAACAGATGAAGGAACTCATGAGCTCCGTTGACTCGGTTGACGCGCTGTTCCAGCACATCTCTCAGCTCGCAGGGCTACCCA
CACAGGACGGACTCGACCCTATACGATCTGACTGGAAACGAGACTCTGCGGAGACGATGCCAGGCATGTTCGATGCCCGCGTGGCAAGCTACGTAAAGAA
CTTACAGGCTCTGTACcagatgacgaagaaggaaaaaTACAGACATGAACAGCGATTAATGGCCGCAAGGGCACACGCCATGTCATTGCGCAAAGTGTCG
CCCCCGCCGTTACCTCTGCCGACGCAGAACTGCCTGACCATGGGCTGGGACCTGGTGGTCATGCTTCTGAAGGCTACACGTAAAAATAACCCAGAGCAAT
ACGAACAAGCTCTGCAAGTGGTGAAAGACAACCTGAAATCTTTGAAGCCGACTGCCTACTCGGACAGTATGTACCTCGCGCCGTCCGCTTCCACGGCATT
CAATCTATTGAGTGAGTGTCTTGGCGAACTGGCTTACCCTGGTACTGATGACCCCCCACAAGACGAAATGCGGATCGGAGCTCGCACGATCGAAACTTTG
GCGGAGGTGGGATTGACCCGCGGTTCCCTTGCAACGATGCTCTTTGTCGTGCTTTGGCTGGTGAAACAAGCACCTACGAGCTCGGTGAATTTGGAAACGT
CCATTGCTAAACTCGCAGCACTGAAAGAGCAGTCCATGTACGGGAAGTGCGAGGCTTCAGGAGAACTGTACAGTTGCGGACAAAATTCGTATGGAGAACT
TGGAACAGGAGACGATATTGAACGACACCAGCTCACCAGCGTCGCACTTTGCGGGTGGGATGACATTCGCCAAGTAGTCAGCGGTAACGAGACCCTGGCA
GTTCTTACGAATGATGGTGCCGTGTTAACGTGTGGGCTCAACAAGAGCGGGCAGTGCGGGCAGGGGCACTTTGACGAACGAGTTATGATGCTCCGCCCTG
TGCACGCTCTTCGCTCTCAGCGAGTGAAGTTCATTGCTGCGAGCAACGGATGTGAGCATATGATCGCACTGACAGACTCTGGGCTTGCGTATTCATGGGG
TTACAATGACCGAGGACAATTGGGGCATGAAAACCTGACGACCAAGATACATGTCCCGAAGCTTATTGAGTcgctgaaggacaagaaacTTAGCTATGCC
TCTGTGAGTTACCATCACAGTGCTGTGATCACTGACGCAGGTGAACTCTATACGTTTGGCATGAACGATTGTGGTCAGCTTGGCCTCGATCACACCCAGC
ACCAGTCGACGCCTCAACTTGTCAAGAGCCTTGAGGGCACAGAAGTATCCACGGTAGCTTGCGGTTTGTATCATACAATCATTTGTACGGCAGCAGGGGA
GCTGTACTCATGTGGCAAGAACGACTACGGTCAGTTGGGCTTAGCCCACAATCGCCAGATCAAGATACCCACCCTGGTCAGCGTTCCAAATGAGATGGTA
TGCTTTGTAGCATGTGGCTACTATCACTCGATGATAGTTACTACTGGTGGGCGGTCGTTTTCATTTGGTCGTAACGACTATGGGCAACTTGGAATTGGAA
GCAAGACTCATCAGAATGTACCAAGCGTGGTAGCCTTATCTGCTAACACACGAATGGTGCGGGCAACGTGTGGATGCTACCACACGGTGCTGCTCTCTGA
ACAAGGGCAAGTTTTTGTCTTTGGGCGGAACAACAAAGGTCAGCTTGGAAATCGAGGAAGTGCAGATGCATTGCTGCCCGTTCCCCTGAAAGTTCGCCCG
GAGAAAAATTCTCGTCGGTGTGTGGATGTCGCTGCTGGGTTCTACACCACATCGCTGATTGTGGAGAGAAAACGCGAAAACGATGATGGCGACTTCGTTA
TGTTGGACCAATCTTGCGTCGTTTCCGTTTGCGGTCGTGTTGACATTGACCGTTCAGGGGAAATTGAGGGGTTGAGCAACTTTGGCTCCATTTCCACGGT
CGGCGTGTCTCTCTTCCGAGGTAAATGGTTTTACGAGGTGGAAGTCGTTACAAGTGGTTTGATTCAAGTAGGTTGGATAGATGGCTACTTCCAGGGAAGT
TCGGACCAGGGTGAAGGAGTCGGTGACCATGCTCATTCGTGGTCTTACGATGGTAACCGCCAGCGGCGGTGGAACAGTGGATCGTCTTCATATGGGGAGA
AATGGAGGGCAGGTGATATCATTGGTTGCTTGTTGGACTTAACCACACAAGAGATGACGTTTTTCCGGAATGGAGTCAATTTGGGCGTAGCTTACTCGGA
ATTAAAGTGCTCCGTAGGCGATAAGCGGTCAGGTATGATGCCTGGTATCAGTCTCGAGCGAGGGGAAATCATCCGAATTAACCTGGGGTATCAGCCTTTT
GCTTATCCACCTGCTACCGGCCACGAATTTGAAAGTATTTCTCGCGCAGTAACGATGCCTTCTTCTAGCGCGGTTCTTCAAGCACCTGAAGATCAACTAC
CCAAAGATACTTCGACATGCCCTCCGCCTCTGGAAGGTTCCGCCTCAACGATGGTTGGCAATAAACTATTTGTTGTCGGTGGAATAATTGTTCACGAATC
AGCTTCGGCCCAGCCAGCAGAACCTACGAACGAGGTGTGGGTGTATGACACTGATACAAAAAGCTGGGAAAGGTGGGCGGATTTCCCCATCGAAATTTGT
CACCATCAAGTTGTTGCAATAGACGACAACCaagttcttgtccttggagGAGAGACAAATTGTTCTGCGTCCCGGCATATGGACCTGTATAAGTGTTCTA
CGGTTAAAAATGTTGATGGCTCCCTCCCGACATGGACGCTGATTCAAGCAGCTATCGGTGCAGCGACGTCGATGCCTCATGCACGTGCTTTCCACACAGC
GTCAACAATCCGCGTACGACTCGATACCATCGTATTCATGTACGGCGGGAAGTCCGTTGAGGATGAGGTTCTCGGAGACGCGTGGTATCTGTCACTCGAG
GATTTCGCCTGGTCTCGATTACCAAGTTCGGTATCGCTGGACCCTGGTCCACGACTCGGATGCTCCTCTGCTGTTATTGGAGAGTGTGTGTACGTGTTTG
GCGGACAAGATCGTGAAGACAAATTTCGATCCGATCTTTGGCGATACAACACGTTTGACCGGTTGTGGCACTTATGCCATGACGACAGCATTGGAACGTC
CAAAGAGGTAACCGCTGTCTCTAGAAGTGATTCTCAAATGATGCTGCCGGAGCCACGAGCACATTACAGTATGTGCTCGGACCTTGGAAACATTTGGATC
TTGGGAGGAATTAACCGAGCCAACACCATTTTGAGTGATTTGTGGTGTTTCTCAGTGGCATCTCAAAAGTGGAGTCACATTGACGTTAACACGCAAGCTG
AAATAGTGGACGGgtgcagctcagcagcgttGTTTGTGCGAACAGGAGCGGTAACCGCGTTACCCGCCATGTCTGATTTCGAACCAGCTATCCAGCAGGG
TGGAGATATGTTTCTTTTCGGGGGCCGGGTTAGTATTCAGGGacaagcagcgagcagcagcagagtgcGAAAAATCTGCCCCGCGAATTCATCAGGATCG
TACAATCTTGATATGACTAAAAACCTATCAACTACTGGAAAGGCAGGGCATGTACTCAGTATCCTTCGCGCAAAGTGTGGGTCTACAAACAGAGCAACCC
AGCATTGTGCGCCGGAGGCCTTCGACTCGGCTGTTTGTTTGCTATCTCATCTGGATCGTTTAGCTGGTAACGATATTCCAGCCGAAgatgttgatgctgt
tcAGTTGTCTCGGTGCTTGTACAGGTCTCTCTGTATAGACCCCAAGGAATGTACATTTTCAGCATTGTACGCGTTACTGGAAAACATGACATCTCGGTTC
TTCGCCATGAGTACGCTAGATGAACAGTCTACTGACACACCACCTGTGACGCACGTGCTGTACCCAATGCTTGTGACGATAAGGCTGCTTAAGCTAAATT
TTTTCGAGGTACGACGACTAGAGCGAAATCTTGGTTGTGACTACTCTCGACTAACCACTTATCTTCTTTATGCCATTAGTTTTCCCGGAGTTGCTTGGAT
GTATCAGAAATTgatcttccagcaactgctaCCCTACCTGGAGGAATTCTCTATTTGATTCGTGAAATGCTTTTTACCATTGCAGACTACGTACCGAAGC
ATGCAATGTCGGGGGAGATACTATGGTTCTATCACGCGGTTAAGCAAGAAACTACAGCGGCAATCTACCACGGATTCTCGGTGCTTTTCCCGTCCCTGTT
GGACAGATTACAAGTGATGAATCGCCTGATGGTACACAAACCTTCTCCTGATGCTGAGCTGACTCAAGTACAGCAATCGTTAATTCCGATGCTCGTTCCA
TGCTTCACATCCGCAAAAATGTTGTTTCAACTGATTTGTGACCCCAATATTCTCTTCAAGGTGGATGGTTTAGCGGATAACACTGTATCTGAAAGTGTGG
TTACATTTATGAATACTCTACTGGACGCACTTTGGAGACAGACAAAATACGCGATAGAGCACTCGTCTGGAGATGCGACTAAGCTCGTAAAGAGTTTGGA
TGCTATTGAGGCGAACGACGAGTTTAAATGCCTCAACATCATGCTGCGAGCGGCGATATTCTGGTGTTCATGTTCCGTCAGCCGAAGTTGGATGATCATC
GAATCGATTTGCTCGAAATTGGTGACTTTTACGTCGAACTGCCTCGATCAACGCGATATTGGACAGAAACAAATATTCCCCAttgtcgtccagcgcagTT
TCTCaggcaagctgctgccatttgTGCTACTAAGTGTGTTTTCATTACCTTCGGTTCGTGAAGCGCTCCCTGCTTTATTGGACCCGTTCTGGCCCCAGTT
AGAGTCTCTCTCGGAAAAACTCCATACCACGCTCGTGCTCCTTAGCAAGCAGGGTAATTCACAATCTTCACGTGGAAGTGCTGACGTATCTACCTCTGTA
ACGGAGAACATTAGCGAAGCTGATTTCGTGGATTCAGCACTCGCATCTGTTTCTAAAGAGCTGTCAACATGCCTCTTGCAGAGTAGTAGCTCTTCCGTCA
CGTACGGTCAGATTTTCAAAAACTTGTGGAACAAGATCAATCAGTCAAAGGGATACATCTCCTGGAAAATTAAAGATCTGccacaagacgaagagatccG
ACGAATTACAATTCCTTCGGACCTGGTAAAATTGTTTGGGACCGAAACGCTAGCTGTGAAAGTTCAACAAGGCACTGCTGAGCGGGTTCTTGAATATGAC
CCAAAGAAGATCTCGTTTGTCCCTAGCAGGACGATTCTCTCGCAACACATATATCCTCTAAGGGAGGAACTACTACCTGCTCCAGGAGGAGTTGAAGCTA
GCACGATGCCTCCCCCAGCGCCACTTCCTATTCCTGGGGTGTGGTGCTCTGATAAAAGTTTCGAAGAAAGTCACGAGTGGATCAAGGACCTACAAAAATT
GGTGGCTTGGATCGGGAGCCACTTTGCGGCTACTTTGATCGTCGGTGGTGAGTTGGATAGTGAGGCTGTTGCTAGCGGTCGATGGCTGTATTCTCCACTA
TTCCGTGGCGGCTTAGACGAAACATGGCCTGATCCTACGTCAGCTAAACCTGAAGTTGGTAGAAATGAAATGCTCCTACTACAAGTGGTGGAAAACGTCG
GTCATGGGAAAAAGCTTTTGGACAAAGTGCGCAATGCTCTGGATCCTGGATCGGCACCAGGAGGTGCAAAGCCACAATTCCGAGTTGCGAGACTGAAGAG
GCAAGACAGTGTGGAGGCGACTTTGGAAAAAAGTGGTGGAATAGAGGCGGTTGACCGCGCAGTTCGAGCTACTTTTGCTGCTCTTTTGAAGCACACTAAC
ATTTCCTACACAACGGAACCTATTTCAAGTGAAGGGGCCTTAGCTGAAACTGTGGTTGATGCCTGGAAGGCTGCGTTACAGCTACGTCGATGGTAAAGTA
TATTGTGAATGGTTCACTTGATTTCGACAAATGTCTGACAATTTTTTTTGCTGAATTTAGGATTGTGCGAGAACAGCAAAAACTGGCTGCAGCATTCAGG
TAAATAAATGTCCGTCCTAGCTTTGAGTATTTGGGGATCTGATAAAGTTAAATATCGTATAATAGTGAAAAGGGGGCTCCAAGCGGGTTTTCTCCCGATA
TGGAGGCAAAGGAACGACAGCAGGCTCTATACAACGCAGTGTGTGAGCCAATTATTCGTAGAGCacttgtacttctccagctgtCACCTGCACCCATCCA
GTGTGCTCCGTCAGCATCGTCCCCGATGAAACTCCTTCCTGGTATTTCGTTGGCAACAACTTACGGTATGACTTAATGCTATTGTGCTTGATTAATTCTA
GCTAATTCGTTTGTCCTTGGTGCAACTACAACAGAGTTTCCGAAGAATTCCCAGAGCGAGTCTGCTGAAGTTGCGGCCCAAGAGCCTGAACAAAAGCGCT
TTACTCGACAGTTAAACAGGATGATGGAAACAAAATCGGTAGAGGTgatggaagaagaagacgaacagaTACACGCGGATATTTTCTCGTTTATTCAGCA
GTCAAGCAGCAATCTGGTGACTACTTCCAGCCGCGAGAGTGAAACATCTCGACACCCCGAAGATCAAATGCGCGATGTCTTACTTGCTCATCAGAAGCGT
GCAAAAATGCGTCTAAAAGGGCTTCAGACCTTTATTCGCCTGCTTCAGTGCACTAAAAACATCCCCAGCGCCAGATTCCACGTTATCCCCATGCTGTCTT
CAGCTTTCAAGCGTGTTCGTATGATCAATGGGCAACAACAAGCGGGCAAAAAGTCCGCTGGACAACCTTCGATCATTAAAGTACACTATCTCGTTGATTT
GGAGTTTGCTGGGTCCCAACTTTCGGCTGCCATCGGGCAAGAGTTCTTCCAGTTACTGGCAATTCTGCTTGAATCCTCTACTGGGCATCTTCGTCAAATA
CAACAACTCATCGAAGTTGGGGTGGGTGCTGCACCAAGTGACACGAAGGCATCGTCGGTGTCCATTCAGCTTGCTGTACAGGACATGCTTCTGGTGTTGG
AGACTTGCTGCTTCCCTTACAAAGGGGAGGATTGGGACCACCTTCACCGTACAAATTTGGTGCGGTTGTTGACAGATCTGGCGAGCTGGAAAGGATGGCA
GAGCTTCATTCGTTTCGATGCATCAGACGACTCGCAGGCTGATGTGAATAGCGCCGAAAAATACGCAATACTACCTGCAGCCACGGGGTCAAAGTACCCG
AACATAATCTGTTCTCGGTATATTACACTTGGTACCGATCTTCGAAAACTGACGATAGCCCACAAGAGCCTTGAAGGAAGCTGTGACAATGACCGAATAT
CGCAGGGGTGTGGGGGGCTTGCAGTGTTTGATAAACCCTTCTACAGAGGCCGTTGGTATTGGGAAGTGTCAGTTCGTACACTCGGTGACACCCCTGTGTT
TGTCGGCGTCACTCCTGGCACAGTAGATCTAAATACCTACCTTCCGGGGGACGCCAGTCTCTGTGGAGTATTTTTACACGGTGAACGGTGCAGTGGGGAC
ATATTGAGATCAGCAGGAATACGATGGAAATGCTCAGATGTCCTTGGTGTTTTACTCAACTGTGAAGAACGCCAAGTGGAGTTTTATAACGGCGCACAGA
GATGCCATGTCGCGGCCTTTAGCTTAAACACTTTGGGAGGAGGCGGGTACTTCCCTTCCATTGGTGTGAAGGATGCAGACGTGCATTGGAATCTAGCAGC
TTCCATTCCATCAAAGTTGTGGTGCGCTAGTTCCAGTTTCCAATTCCCGAACACGTTCGTATCTGGAGGACTCGTGGCAGCACCTTTTGATGGAGCAACA
GTTAGCTGGAACGGAAAGCTGAAGGGTAGTCGCTTACAGCTCCTGTCGAACGGAACAACTGTATGTGCTGGTGATTCCAGTTCATCAGAAGATCAATTTG
AGACTGTTGTTGCAAGTCAGGGCTTCGAAAACGGCAGTATTTTTGTGGAGGTGCATGTTGTGGCAGCAGGAAAAGACGGGCGGTCTGCACTCAGCTTTGG
TATTGTCGACAAAACGTAtttggagctggatgtgCCACTTCAGCACAAACTGGATgtgaagtggaagagcgTCGAAGAAGTGTTAGAAGAGGGTGTTATT
GGAGTTTTGTTTGATTTCGATAAGGCCACCGTAACGCTGTGCTCAGATCGATCGGAACCTGAAGTTGTCCAATTCAATGCGGCAATTCTAGCAAAGCCTC
TGTTCCCCGCAGTATCAGCACTATGCAACGGCACAGTCTTTGATGTGAATTTCCACCCACGACCCCGTGCCGAATTACCTTTACACATTTTCTACCCCGC
AACGAAGCTTCAGAACCAGCTCATGGCTACGTCGAACGAGCTACAACTGGGCAAAAGCCTTCAACTGCAAGTGCTTTCGTGTGACGGTGGAGAGTTCAGT
AGTTCTCATGCCGCCTCTAATTGCCTGGTGGACGACACGACCGTGTATAGCTCCACTAAGGGAGCCAATGTCAACCTGGTATTCAAGCATGAGGTGGACA
CTCCTATGTGCGTAAGCTACATCAATATTCGAGGACCAGGACCGGGATACTCCAGTcctcttcgagctgctgtcgtgtTTGTCACTAGCACACCACCAGA
TCTCTCGTATTATCAAGAATTCGACAACATGACCGCAGAAGAGTTTGCTGCCTTGCCGTTCCCTCCAAGTAACGGATGCTGCCCTCGAGACGAAAATTTG
CCTGTTGCATTCTTCGTAATGGACGGGAGCTGCGCCCAAGTTTCCAAACAGCTAGCCTATCCAGTTACGGGTCGATATATTTTGGTGAAAGCAATTTGCT
CGTCAGCGGGTACGAACATCGACATCGGATATATCGGATTTTGCGGTGTTTTCGATCGTGATAATGGACCTGCGTACAACGAGGCTGCGTCGGGATCTTA
CAGCTGTGAGGAGTGCAAGAGGATGCCGCTACCTGGGGTGCATTATGGACAACGCGATGATGACAGCATTAAGCTGTGTGCAGCCTGCTACGATGATAAC
CGAGGTGACCTCGATGCTGCCTATTTTGTCTACACTTCCAGCGCTACTGAAGAGGATCAAATGGAGTTGAACACACTGCTTTGCCCTCCTCGAAGATCCT
GGAATGATAAGATACGAGCTCTAGGTGGCGTGTTGGACATGAGTAATGAGTCAAATGTAGCTGGCGACGGACGTGCAGGATCTGCCGCAACAGGACAAAC
AAGCAGATCCGAAAGACTATCGAGTGTGGCCAGTTTCGATGATTGTGAGTTGTTTTCTTGTGGGCAAAACAACTACGGAGAACTGTGCTTGGGGCACTGC
AACTCGACAAGCAAATTGGAGCACGTGCCGTTCTTTTCAGCGAAGGGTATTCGTGATATCGCCGGTGGAAATGAAGTTCTCTCGGTAGTAATGAAGGATG
GTGCTGTGTTCACGTGCGGTCTCAACAAGAGCGGCCAATGCGGTAATGGGACGTTCGAAGAGAGAGTGATTATCGCCACTCCCGTTCGTGCACTCAGTGG
AATCCCTATTAACATGGTTGCAGCAGCTAATGGATGCGAGCACATGCTAGCGGTTGCTTCTGACGGGGCAGTGTACTCCTGGGGCTACAACGATCGAGGC
CAGCTAGGCCTTGGATCTACGATTTCGAAGAGTCATACACCACGAATGATTGATAGTTTGCGGGAAAAGTATCATATtacgacagcagcagtcagcTATC
ACCACAGTGCGGTAGTGTCCAGTAATGGCGAGTTGCTCATGTTTGGTATGAACGATTGTGGCCAATTGGGTCTTGACCACACCCAACATCAGCACACGCC
GCAATTAGTGGACACTTTGTCAAGCCAAGTTGTCACTAAGGTGGCATGTGGATTGTACCATACTGTCGCAGTTACCAGCGGAGGAGAGGTGTACGCGTTT
GGTAAGAATGACTATGGGCAGCTGGGCCTTGGTCATGCCCGCAACATGAAAGTGCCAGCGCTGGCAAAAACCGCACTAGGAGAGAGCGACGAAAAAATCG
TCACTGTTAGTTGTGGATATTATCACACCGTGACTATCAGTGAGAAAGGAAAGCTTATCACATGGGGACGCAATGACTATGGGCAGCTGGGAATTGGAAG
TAAAGAACACAAGAACAGTGCCCAGTTTGTCCCGTTGCCATTATCATCAAAGATCACGACTGCGTCCTGTGGATGTTACCACACACTTATCCTGATGTCA
AATGGGCGGGTGATGGTTTTTGGGCGTAACAACAAGGGTCAGCTTGGGGCTGGGTCCAGAACGCTTCCATCGGCAGACCTACCGTTGCCGGTGCCTTCAA
ACTCACTGGCAAATGATGAAGTTGTTCGTATAGCGGCCGGATTCTACAGCTCGTATATTCTCACTGGCCGCTCAGGCGATAGCCGTGGCCTTGACGGCGA
TTCCGACGATGCCAGTCAAGCAAAGGACCTCCCAGAAAATAGCTGTCTTGAGAACTCCGATGCTCTATTCGAGTCGTtgatgaaggagattgaCTCCAAG
TATATTGGGGAGACTTCGGTGACTAAGCGATTGCCACTCCAGATCAAGCGTGGCTATCCACAGCGCAAATTACCATTAGTGAAGCTTCATGCGGCTGGGT
GGGCAATGGCTCGCGCTCTGATGTATCGATCTCTCCAAGATGCCAAAGACAGTAACAGAAGTCGTTCAACAAGCGCGCGTGTGAATCCAGTGCTGTCCAC
ATTTATCAGCTTTTTGCTGGAAAACCTGAAATTGTTACAAGATAATTCTACAACTGGCAACAACACGATGACTGCGGAAGCGTCCCACGAGCTGGTAGCG
AACGCGTCATTGAAGCGTGTGTGTGTTAGTTTGCTGCAATATTTCGGCTCAAAGCTCGCTTTGCCCTCCCCGGCGTCTGGGACAGTAGGGTCCAACTCCC
TCCATGGCCACTACTACCGGAATCAGATTTTAAGTGTTCTTCTCTCCTGTGGGTCAGCGAATACGAATGTTGGTGCTATCATCGCTACCAATGCAGTAGT
TACAACTCACATTATCACGGGGATGAATTCGTCCGACTTGGCATCGGCAACTGTGTGCATTCGCCTAGCCATGTTGGTCTTCCCGCAGCATTCAGTGTCT
GCACTCAACAAGATCTATCGGTCTCACCAATCTGCTCCTGCGCTCTCCGGAGACATACTCAGCATGCTGATGGCGTTGGTTGGACTCCCACTACTCTTAA
GGCCTCGCCTGTGCTCGCACGAGTTAGGCTTGGAGTGTTCATGTACTGCGTTATGCACGTCCGCACGATGTCTAAAGGGGGTAGTCGTGGCCAAAGATTT
CGGGGTCGCACAGGTCCAGCAAGAATTGCTTGAGAAGGCCCATGTTGCGGAAGCAAAGTCAGCTGAGGTTGTGGCTTTGCTTCGTTATCTAACGCTTTAT
CCTACATGGAAAGTAGCGATTAACGCCGCACTCACCCGAGGGTTTGCCAAGTCGAACCAAGTTGGCTCGCTTCTTGATACGGTTTGCGCGTACTACACAA
GCGTTCAGGAGGCTGGAAGTGTACTAACGTCTGGATCTCATTGTGAGTTTGGAGGCGATACCGACACAACTTCACTAAGAAAACCCGaggcagcaacttc
atctcCCGAGACGGACGAACCAAGTAGCAACACAACCGATGGCAATACCGGGACCGAAGATTTGGAAACCGCCCGCGACAAACAGTCGTTAATCTTGTGG
CAGAAAGCCAAAGACGCTCTGGATGTATTAGCAACGATTGCAGCGGCCGTAAGTATTGTCGGTGGAAATGTTGTAGGCTTCAGGGAAGGTGGGTACGTGG
CTATTGAAGGTGAAGGGTCCAATTCGTTTGGTGTCCTGTCAGGAGTTACGCGTGATCCACGGACAGCTGAATTATTAGCTCAAGTAGTGGTCGAGGTAAG
ATCGGATGGACCCGTTTCGCCATTTGTTGAAGCGAGTTCTCGAGCCCAATCTTTCGCGCTCTCCAAGCTCCATGTTGTGGAGCGCATTCCAGCACTTGTG
GACATGTTTGACGATGTGGAAAGCATCATATCAACACTATCGTCGTTGATTTCTGCGGACGCTTTAATCGATGACGAGTGCACAATACACTGTGACCTAG
AGCTCCCTCAAAACAATCCCGTCCAGGCGATTTTGCGGAATCGGTTGAAGATGTTCAAACAACAGATAGGCTGGCGTTCCTCCAAAGCACTGTCATCTCT
ACTCAAGCAGGTCCCAGCTCTAAGTCCAGCGCTCTTACATGCTGAATCTGAACTGATATCGACTCTAGCCACACTGATAGCATCCGAGAATTCCTTGTCG
TGGGCGAGCAAGTCTGAAGGATCTGGCCTAGAAGCTGCCAATTCTCTGCAAAAGCGATGGATTTGTGTGAAACAGCGCCAAATGTTCTTGGATACAGAGG
AAGTGATCGACTCAGCACTGGATCATTACGAAGTTAACATGCGGAACGAGGTGATTCACAAATTGGGAAGCGAAAACGCTTTGAGTTGGGGGATGGATGC
TATTCAATCGCCTCGTCGAAAGGTGAACCATCCGTCatttgctggagctgcgtcttctggtTTTGGTCGTGGGGCTGGACAACGACATGAAAACCGCTCG
AATGAGGGAGATCTGCCGTTTGGCGCTTGGGGGGTCTTACTACCTCTTCCTCCGTTGAACGAGAATGAACACAGTCAAGCTGGCGCATCAGGGCAAGCAG
CTATCGACTACGCGCCCTTCCCACTCACGACTCCTATCATTCGTGTTGGTCGCGCCGCAGATGCATGCGACCTCATCGTTAACGATCGCAGTGTCAGTGG
TCGCCATTTCCATTTGCGTCGGTTACGACGTGAAGCTGAGGGTAGCGAAGAACAGTACGAGCTTCAGGACTTCAGCAAGAACGGTACGATTGTTAACGGC
GTGAGAATCCATGGCTCTAGCACACGAGTCACTACAGGGTCTCGAATCTCCCTAATACTGTCTCGAGGTGGTCTAGTGACCTACGAATTCCAGGTTCGAA
CATCTACAGGCAGTATTGGAGGGCGAAGTGCGCCACCCCCGATTCTCACGGCGCCGCAGAACTCCGGAGACCTGAATATCTTAATTCCTGGTCAGGAATA
CCAGCAACCGCAGATTGGAACACCTCAAATCGTACCCAGAAGCCCAGCGGAGCTACAGAATCGCGCCTCGGGAGTAAGCCGTCAGGCAGTGACGCAAGGA
TTGCGTGTGATTACCTCTGTGGCAGAAAGTAACGTTCCTCGAGCTTTGTTATCGCCGAACCCCGCTGTCGATTCCCCTCGAGCTGGCGGGTATAATTCAC
CCCGGTCCTCAGTTCTTCAAGCCCCAGGGACTCCTGCAGCCGCACCTCCCACTCCTAGCCTGTTTTCTTCGATGATTCCAACAGCTATCCTGTCTCCTGC
CTCCTACCAGCAACGAGAGAGCTTTGGACCGAACGAACCCACTGGGGTCACGTCACctcgtcaagaaggcggagtCGGGTCGATGCTTCGTATCGCACTA
GGTCGAGACAGTGTGAATCGTGACTTCTCTTTACAACGATCAAGTATCCCCAGCGAACTCTCGAAAACCCGGGTTTTACGCTCCGGTGGCGAGTCTGGAC
CGACGGTACGTTCGGTACGTAACTATCTTGGACTTTTTTGTCTGCCGTAAACCTAACGACacgtttgctgcttcttttgATGTTTTGTAATGGATTCAGA
ATGCTCAGGAGATGCAAGTACTAAGCCTACGCCTGCTTGCTCGCGTTCAAGAAGCAAACTTGGTGGTGAGTACGACTGAATGTGAAGAAGCCCTCCAGAT
GACAGCCGGTAATTTGGATGAGGCCTTCATGGCGATTCAGCATCGCCAGGGGTTGGACGTGGTAAGTGCTTACCCCATTTGTTATGACCGATTGATGCTA
ACTAGTACAATATTCTAATATTTTTACAGCACAACTATCCGTCCAATGTCCGTCATTTAGCGATAGTCCTTGGCAAACCTGAACGAGTATGTGCTGAGGC
TTTGCGACAGACGGATAACAACTTTGGAAATGCGCTGCGATTTCTTCTGTCGGACGCTGGTACTGAGCTGATGAAGTCTGTATTATCACCACGACATCAA
GGTGCCGGCCAATCAAGAGATGTGCCCTACATTGTGGGGTCGAATGAACAGAGTAGTGAGCCCTTGGTAAACTTCCAAGACATTGGGGACGAGAATCCAA
GCTACACCTTGACAGAGTCCAGCGCGCTGTGCCCTcctctgcagcagcggcttgcATCTCGAGGAAATAGCAGTCccgtgaagacgaagaaaatGGAGCG
CTCCATCAACGCGAGTCTGGAGCCAAAGTCCGACCTGACACTCTGGGGCGAATGTAACAGCAGTTTCGACGACGGAATTCGCCAGCTGAATGCCTTTGAG
ATCGACctcgaagaggaagttcTATGTCAGCGCCTTGCCGCCGTTCATGCTCGAAAGATTCTACTTCACGTTGTCCGGCTGGTGGATAACGCACCACAAA
ATGAGGAAGCACCCCTTAACGAGCTAGCTAATCCCCTGGTTCTTCGGCCGTTGATATCTCTGCTGAATACGCCTCGACCAGCCATCACAAGATCTCCCTA
TGAGCTGGAGTATCAATTGCAGCAACAGTCGAAGGCTCAAAAGTCTGGAAAAGTTCAGCAGATCCTCTCTCGTAGGACTCATGAGGTGATGGCGAATTCC
CCAACGCTGACGCTGGCAGAAAATTTGAGCTCGTCTCAAAACCTGTTAACTCTCCAGCAGTCAATTGACGAGGTGATCGAACAGCCCTCAAAGCTAGGCT
GGGCTGGCGTCACTCGCCTAATCGAGTCCCTCGTTGAAAGTGAGCAGAACAGAGGGGCCACCGCAGGGGAAGACGTCAACATTCCGGATCAACCAAGTAT
ACTGGAGAACGTGACATTCGAGACAATTCTGCACATTATTTCAAGAACTCACTCTGCTCCTACCACGACAATGAACTGGGAGAGTTCACCACTTCGCACA
CGCAAAGTGGATAGGCAATACCCGAAAGGACCGATGCAACTATCTTGCGGtcttgaagttgttgtaGTTGACACATACGAGCGCTTGTGGAGTATCCCTC
CTCCCGATCCTCTGCTCAAACACCGTCACAAGTGGCGGAAACGATTTTCTAGCCCGTCGACCAGTGACAACGGCATGAAATCGACTGCAGATTACGCTGT
GACTATTTGGCGTCCAGTTGTGCCACCAGCTCTGGAATCTGCCACGCCAGGCAGTAATTGGTTCTTCCTCGGGGACGTTGTCAAGTGTGGTAACGGCGCT
CCAGACTCTCCAATAATTCTTGTCAGCGACAACGATAACCGAGGGTGCTTAGCACCTCCGGTAACCTTTGAACGAGTGGATATTACTGGAAAGGGATTGC
CCCGAAATTCGGAAAGCGATCCGGATTTCCAGCGCAAACAACTTCGCTCAATTTGGTGGCCAGTAGCTCCGTCTGGATACGTGGCTCTAGGATGTGTAGC
TGGAAGCAAGGAAGACCCATTTGAACCTCCTGATGTCTCTTGTACGCGCTGCGTACGTGAGGATCTGGTGAAACGTGTGGAGACATTCAACTGCGTATGG
CgtgcatcttctcctgcatctactggaggtggaggcgtGGAACTCCCCACCACAGTCGAAATCGAGaacgaagctcaagacgatGAGGTTATGGGAGAGA
ACGATCAGGTCTTATTAAGTCGCAACGTCAAAAACCAGTCGGCTGACTCCTCCAGAattcagctgcttcttcccGTGGCCGATGATGTAGTTGTCCAGAC
GTCTCTTTGGGCTGTGGATTCGGACTTTAACAGTGGTCTGCTTCTACCTGTGGTCACATTGAACGATACGAACGCTAATGATCCCAGCACTGCGTTTGCT
TTAGATCTATCTGACGAGGACACCGTACTATGCGCACCGATCACCGTGGACAATGTACTTGCCTTCCTCGAGGTTTTACTTCACTACCATGGATTGATGT
CTGAAAAAGAGCATGGCAAGTCGATTGCTGCGGTTCAATTGCGTCCTGAGCTTCCGTCGGCTTTATTTGCACTAGTGCAACAAATACTGCGGGAGAATCA
ACCATCAAGCGGGCAACACGCAGTAGCTCTTCTGCGAGCTCTTATTACGGTTGTTCAGCGCGGGGCTCGCTGGTACGACAAGCAGTCGCTCATTTACTGT
CGTTCCAAGATCATGGCGCTcagccaagaccaagacggcGGGTTTACGCTTCACGCTTTGTTGCAGGCTTTCGTGGAGTTGATGTTGGCGGTTGAGGATC
AACAACGCAGTCAACGAGTACAAGAGTTAGCAGCTTGTTTTGAAGGCGACGGTAGCAGCACACTGAGCCTACCGTATCGCTTTCACTTTTCCAAGCAGCC
TCTTGTCGAGATGCTGGTGAGTCATTCGTCCAAGATGGCGGTCTCTCGTCATCTATCAGGAGAAGAGCGCAAGTTCTTGCTGGACTATCGGGCTGAAGAT
GGCAGCAACTCTTCATCACGAGACTCCATGGCAGCTGAGGGGCTTGGAGTACCGCCTGGGGAGGTGTATTCTTGCCGCTTTGAGCACACACCAGCCCTCG
TGATGACAATGCGAGACGAGGTGAAGGCTGAAATTGTGTATTTCGAGATCACTGTAGTGGAGTGgagcactggcagcagcatggGTGGGTCACTTGCTCT
CGGGTTTTCGCCGCCGTCATTCCCGCTGGAAGGAGTGTTAGTGGGTGGTAGTGCAGACAGCTCTCGGTCTTACTCGTTTACACCAGCGAACGGCCAAGTA
CTATGTGCGGGTGACACTGCTGTAGATCGATGGCGATGGATTGAACCTACCGGTGCTGTAAGTGCAGGTGATGTCTTTGGCTGTGGGTTACGTCTCGACA
CTCAAGAGAttttcttcaccaagaacgGACAGCTGTTAGGCACTGCTTTCTCGAGTATTTCGCGTCCTAAGCAGCTCCACCCGACGATATCTTTCAATGC
AGACTGCAAGCTTCTCGCCAATCTGGGAGCTACGGCGACAACATATGTAAAGAACGCAAACTTCAGCTTCAGGTTCCATTCGCTCGACTGCGACAACCTG
ATGAGTGCTTTTGAGTGGTTCGAGCCGCTAAGTCAAGTTTACGGTGTgatgaaggcgctgatgGACCCGGCTAGGACGGAAGAGCTGAGTGCTTCTGACG
AATCAAGTGACGCTGCTATTGTGGCTCAACTACCAGACGAATTCATGCTTTCCGCTGATAATTTCCTGTCGGAGATTTCGGAGGATGTGTGCATCCGCGT
GGAAACTGCGCATCCGTATGAtctggagcttcaagagTCACTTGTGAGTATCCCACTAGCTACAAGCATTCGGGTGCGTCTGGCTCCTCAAAGTGAGACG
GCCAGTTCTCATTGTCTACAGATCCTCCAAGGTGGGGGCGCAGGTAGTGAAGCTGGGGCTGATAGTGCGACCACTGGAGGCAGTGAAGCCGAGGTGAGAG
CGTTTACTGGTGCCTGCGGAGGGCAGGAGGTCACTATTGATGGGGATAGCTTTGTGTGGCGGTTCCCAGTTCAATCGAACTTCCAGTGCCGTGTGGATCG
TGTACGAAAGGGCCCCTACCTAAAGCTTGAAGCTCGGGATACCCGACTTTCACTCGTGCGCGATAAGGGCTGGCAAACAGCTATCGGAGTGGCCCGTTTC
GATGGAGGAGTGCACATTTGGGAGGTGCGCATCACTTTTGTGACTGCAAGTTCCAACATCTTTTTAGGCATCGGTCGCCGAGACGTTCGACTGGACTCGT
ACTTAGGCAAAGATAACCGCGGCTGGGGCTGGATCGGCAATCGGGCACTGTGGCACAATGGAAGCAAACAACGAGGCACTTACGGCGACAAGTTCAAGAC
TGGAGACGTTGTACGGCTCACCCTGGATCTACGTCGAGGTACATTGAGTTATGCTCTCAATGGGAAGGACCTCGGTGTTGCCTTTGGCCCTGGTGGCACG
GGTCCCAAGCTCGAAGGAACGTTTTACCCTGCTTTTGCGCTGTATAACCAACGCGACTCGATTGACCTCATTGGGGGACACCGGGTCGAAGATGGAGGAC
TAGAACCAGGTCTACCtcgaactggaagtggaCTAGCAAGTGGAGAGGATTCGTACtacagtgaagaagaagaagacctcGGAGGTTTcgcaggtggaga
agaaggcgtcaGTGACGACTCCATCCCGAACTTTCGGATGGAACTGGGTATCGCTCTCAGCCAAATGGGATTCCCGATGGATTGGTGCATTTACGCTCTC
CGCCATTGTGAAGATGATGCGGAACAAGCCGCAGACTTCGTTCTCGCGAATATGCACGCGATGGAGTCGCTTGTACGTGAAGAGACAGAGGCGATGGCGC
GTCGTGCTCGGCACCGTCAGCTCCTGCATGAACAGGCCTTAGCTCTATCTGAAAGTGTGGATGGTGAAGTGGTAGATACAGCTACCATACCACCTCCACC
GCCTATCGAGTCATTAGGCGATGGAATTGATGCGGACATCGCCGTTCGATCAGCAGAAGAAGTCACAACAACTGAAGTATTACCGTCTCCACCATTACAA
CAACAGTCAACCGGGGACACAAAGTGGGGTGTAGCATTCACAGCCGTCCCGGAATTCTCAATAACTGGACGTCGTCTATTAGCGGCCAAGTATGGTCCCA
AGCTGCGTCGTTTACACGCTTCGCAGCAGATTTTTACTCCAACACGTGATCGcgctctcgtccagctcgtaAACGAGATATGCGAGTCCCGAGCTGAGGC
TTTGCTGACTTGCGACCCTCTACGTATGGCTCCAGAGGAGTTTGTGCCTACAgaggagcagatccacgccTTCCCAGTACTACGAGGGCTTCCGTTGGAG
GCTCTACAGCGACGCTTCTTGGTGCTACGTAACTTCAACTGTCGGCTGCAGACCTCGTTAGCTTTCATCGACTTCTCAGCCAACGATGAGCGTTCTGTGC
TagctcgtggcgctcgtgcCCTTCGAGGCGTGGTCTTCCAACACGTGAAACTTGCGTGGTGGCTCGGAGTCTTGAAAGAACAGCAGGCCCCAGCCGCAGC
TCGACCAGAAATTGAGGTCGATCGCCATCGTGCTCAcgatgcgctggagctttccGAACGGGGAGATTCGCtggcagttgaagctggcgagcgTGATAGT
GTCTTTGCACAGACTTTCGAGCAACTACATGGTCTTCAACCAGCTCTCTTGAGAGGAGCAGACCGAGCCTTTAAGTGCCAATTTGTGGGGGAGTTTGGGG
ACGACTTCGGTGGGTTGTACCGCGAGTGCTTGGCCCAATTAAGTTGCGAACTGCAGACGTTCACGCCTCtggttcctcttcttcggccgTGCCCCAACGC
ACTCATGAGTACAGGGGAAAACCGAGAGCTTTTTGTACCGAATTCGCACTTACGCACAAACGCTCGACGTGTGCAGATGGCCGAGTTCCTCGGTAAACTT
GCAGGCATCGCTGTTCGGACGAAAACGCCACTGGATCTAAATCTCCCGCCAGTTATCTGGAAGTTGCTAGTGGGGCAGCAAGTGATGCGGCAGGATATTG
AAGCTATTCATCAAGGATGTTTCCAGGTGGTCGACACAATTGCTAACCTGGATGCTCATGGCATTACGGAGGCCATGTTTGACGAGATCGTGGACGCAAG
CTTCACCGTGCTGTCAAGTACGCGGGAAACGGTCGAGTTGGTTCCTGGTGGGCGACATTTGCACGTGACTTGGGAAGATAGAGTGGAGTACGCATCCGCT
GTAGAGGCCTATCGGTTGACAGAATTTGCGCCCGTGTGTGGGGACATTTCCCGTGGCATGGCGACCATGTTACCAGCTCCTACGCTTGGCCTTTTCTCGT
GGCACGAGCTGCGGACTCTGGTCTGTGGCAAGGCCTCGGTGGATAtctctcttcttcgacggcGTACGATATATGGAGACGGCTGCCAGGCTACTGACCC
GCATGTCGCCTACTTCTGGGATGTCCTATCTGAATTCAGTGCTGATCAGAAGTCGTCGTTCCTGCGCTTCGTCTGGTACGGTCTTCGGTGATAGTGGATG
CTTTGAATGTGTTCTCATAACTCGTATTTTGTTGTCTATAGGGGTCGATCGCGGCTGCCTACCCATGCGGCAGACTTCACGCAAGATTTCAAGATCTCAG
GGTTGCCTAAGGCTGCAGGACGTGCCGATATGTATCTGCCTATCGCTCATACCTGTACGTTTGAAAGTTGTTCCGCTTTTGCTTTCTTCTGACCTGACAT
TTGATTGTAAAtggttttttttttcaggcTTCTTCTCTATCGACTTGCCAGCTTACTCCAGCAGAGAGGTCACGCACGACAAGCTCGTGTATGCGATCAC
TCATTGTCAATCTATTGACGCAGACAACACCACTGTAGCGCAACGGGCAGGCCAAGGAATCAACTGGACAAACACTGCCGCTACGGccacagccactgca
gctgccgCTGTCTCGAGTGTCATTGCTGGAATGGCCACCATTGCTGGGGAGTAAGCCATTTGAAGCTGCATATACATATTTTACATTTTCAAGGGTCCAT
TGCATTCATCACAGCGTTTCTTCTCTTTTATTCGGCCTCGCTTGGCATACTTTTCGTGCGAGTAATCCGTAAGGGAACTGCTCGCTTGAATGCTCGCCCC
CAGTCCCCATGGTTAGCCACCTCGTTAAGGACCATGATGACAGAATCCACATTCATGACGTGAGTTCTCACCCGCTTCCCCGCTTTTTCAAAGTATTCTT
GAAGTGGCAGTCGTGCAGTGCGAATATCATGTGAAGTTGCCTTCGTCTGCGTTTCACCCTGCTCACAGGGCCAGAACGTGTTAGCTTGGCAAATTCCTGT
TTAAGAAACTAAAGAATCAAGCTCACTTTTCGAACGGAGCGATCTACGATACCACCAACGACGTACACGCAGGTTGGATCAAGCTGCTTCAGAATATTTT
CTGAGTCTGGTGAAAGGTAGACGAGCTCATTGGGATCATAAATCTGTTCCAATGCACCTTCATGTCTTCCAATCTGTCCAAACGAAAAATAAATATCCGT
ACTAAAGCCATTCAGAGCAGTCAAACATGTACTCACCTTCCAGCTAGGCACCCCATGCTGAATACAGATAGCTGCAAGGTCCTGCGTACACGACACGAGG
TGTAACGACACCAAGTTGTCTAGTGGACAGCTTTTCAGATACCCGTAGACACACccgagctgcttgaaaaTGCTATGGCGCTCCTACACCGCAAAACCAC
ACGTTAGACAAACAGCACTACATCAATTTTTACAAGACAAGAAATATGCATACTCGGATCGTTTGTTGCGATGCAAAGGCAAGATCCACCACCACCCGAA
TGCCAGTTGTTTgagcctcctccagcttttgctgcaCAACGCATCCACCCTCATTAACTCAACGATTTCAGACCTTCAGTACAGCTGGGAACTCACATAT
TGCTCCACTCGCTGCATTCGGATACGTTCTCTTTTCTCGCTCTTCTGCTCTTCCGTCATCTCGGCCTGTTGCGTTGCCAGCGCTTGACTTCGTTCCTGCT
TCTTGACTTTGAGGCGCTCGTCCTTGCGGTTGCGGCGCTTCGACCGCTCCATTTCACGGCGAAGTTGCTTGGTAGGTCTTTTGCACACCCTGAACCAATG
CAGACCATGACAATACCCGCTGATTCCCACTGCACAAGCCGCGACGATCAGCGCGATCGTCCATGGTCTCATCTTGACAAGTTGCCATATTTTTCGTAGC
AACTAGGCATGTGATTGGTTGGATAACATACAAAAAACGTTacgattggctgaaatgtTGCTGGTCCTGACGCAACGATTTCCAAAGACAAAAAGGTCAT
TCAACAATGGGGTCCAAGAAGCGACGTCGCTCGGACAGCTTCCACGCAGAACAGGGCGATGATGACGCTCGTAAGCGCCTTGCAGCTTTCCATGAGCGTA
TGTTTGATCTGCCGCAGGAAAAAGCAGCTGAGGTGGCCTCAGAGATGCCGCGTGTGGTGTTTAAAtccaagcacaagaagcacaagcacaaATCGGGCGA
TGCAGACGATGACGAGCCTATGCCAGTGATAAAGTTcaacaagacgaagatcaagaaggagaagaagaagaagatgaagatcgtATCTGCTGCAACTGTG
aaacttgctgctcctgtcAAGGTGGCGAGTCAAGCCGTTGTGAAAAAGGGTCTGGGGAAGCAAAGTGAAGCCAAAAACAAaccgaagaagatgaagttga
aggtggcgaagaacgttgaagtgaaaattgagaagatgaagccgaaCCAGGCTCCACAGTGGCATTCCATGGCgaaagaggacgaagcaAATGACGACGT
GGATCAGTTGGAACAGGCCCTGGGGAGTATGAAGGAAATGGCGTCGAAACAAACGGCCAAACCGCTGCGCAGGAAGGATAAGGCGATCACAGATAAGGCA
GTGGTcgtgcagaaggaggaaaAGCCGGCACTACGGGATGAATCTActgaggagaagaagcacccGTTGAATAATCCGGAGGCCAGCAACTGTGGAGACG
CCGCAGACCACTTAACTAAATCGCAAAGgcgaaagaggaagaagaaaatgctgAAACTGTTGAAAGCACAGGAGGAGAACAGCAGTGAGAAGCCTGCACA
TGAGACAATGAAGATTAATTCCTGTGAAGACAAGATCGAAAAGATGGAAGTTACTGAAACGACGACCGGAGGCAAGTTACCAGTGAAGCAGGCGGGGAAT
AAATTTgggccagctccatcgacCAAGTCACCAAACTCACACAAAAAGCGGAAAAAATCTCCGAAGGTGAAGTCTGTATCGCCCAATAAGCATACAGCTG
CACAGCCCAGGCATGGGAAGCCGCTGATTGTCTCCGACGAACCGGATGTTGGAGCTACGGCGTCAACCATGGACGCCAACTCCGTTGCATCCAAGACAAC
GAAAGCCGTGCCCGGAAACAAGCTCAAACAGGCTACAAAGGCCTCAGTGTTACCTGAAAAGGTTGTTCTTAATGAGAAGACTACGAAGGGCTTGACTCCG
ATTGCGGCCTCCCTGGCCAAGGatgcgaagaagaaggagaacgatATGTTTTTGTCTGCTTCAGAGACTTTACTTAAACCTGTGGTATCGACAGGCTTGC
GCGACGTAACAGTTGCTTCAAATTGCGCTGATAAAGCAAGAACTTCCCCAATTATTCAAGTTCCTGACgcgtcctcatcgtcagaAAGCGAGGATGATGG
TGGATTTGACTTCGGCTCCGGTGGTGGTGACAACTCGTCATTATTCTCTCGTCTCATTGATTCTGCTGCTAGAGAGCGATGGGAACTAATCGAAGTGGGG
CGGCTCGTCCGATTATTTTCTGCCGAGTGGAATTTCAAGGAGAACAAGACCGCACAATTCCTGGAGGATACCTGTCCAGAGCTGGTTAGTGTCGACTTCT
TGGAGGGATTGGGTGTGAACTTGTCCGCGAAGCAGCTTATTCGTGTGTTTGAGGCTGGCTCAGGCAACtcggaggtgctggtgaaCAAAATTGCGTCCGC
TGTGGAGAATGGACACTTGAGTGTTCACGATGCTGATTTCGTTTCAGCCTTGGAAAGGCGTGTAGCGCTGATGGAGTCGAACGGTGAAGTGATGCAGTTT
TTGCACCCACTGTTGGAAAGTTTGTCTACTGTGAGAGATGTCGGTTGCctactgaagaagctgtgcgAGCACTGGCAACTCGAGCGTAAACTTTcactgg
tgcagcaggtgctgtTGTCGAATGTGTTTGATGATCTGGACGGCAACCAGGATGAGATCCTTGTGGACTTGCCTGATCTAACTGGACGACTGGATTTTCC
GAGCCGTCTTGACCAGGAAGATGTTGACGAGAACGGAAATCTGAAGGGATTCCTTGCtaacgacgacagcgaatATAGTGGAGAGGAGGGctctgaagaa
gatgatgaagaggaagagatAGATAGTGAAGCCGACGAGAACCCATACGAAGGCGAGTCTGATTCGGATGAAGAGGTTGAAATAACTGGCCGTTCTCGAG
GCCGCAACCAGTTTATTGAGGATGAAGCCGATGtcggtgaagaagacgaagaagaagaagagcaacctCACAGCAATGCTGGGTCCTCGTCTTCGGACAG
TGATTAAGATCCTGTTAAGATGTTAATAGCGATTTCAATAGTCAGCAACTTGAATTAGAGCCTGTACTCAACCACATTCTACTCGAAGTGTCGAAACGCA
GTTACGATCAGTAGCAGACTTTGTAAGTCTACACCTACGATGAAAATAACGCGTTCAAGACAGCGAGAATGGCAAACACCAAGGCAACCCACATGTAGGG
AGCCACACCACTACCctccttgctgctcttggaaATCCTTTTCTTCGAGTGAGCTATAGCGGCTGTAATAAGTTCGTTAGACGCCGCGGGTCAATTAATT
AAGCAACCAGATTGTAAACGTACCAGCTCGCGCCGCAGCAGTGTTATCTTGGTATGTTTCATCGTCCTCACCCTTGCCGCGACGACCTCCCTTCTTTGAG
GACTTGACCTGCGACTCCTCTACAGATTCTTCCGCATCGATATCCTGCTCAAAGGTCTGCTGAGCTGTCAAACCATTGTTGCTAACCTCTGTCATCAAGT
CTGGGAACGCAGTTGTCAGCGTCTccgcagctgcagttggccaGTTGGCCGTCGGATCACAGTGCATCGCTTCCGAATGCAACGGAGTGTTCCCGTGACC
ATTCTTAAGAGGTTTTGCTCCCTACAAGCGTCATCGTTCAACATGGCATCCATATTTCCTTTCAccacgagcagaagcacATTACGAACCTTGGAGATCA
AATAGCTGATAAGCTCAAGCTGATCGTCGCCGTTCTTAATACACGCCCAGTGCCTACAGACACCACCATCGATTAGTGCCAACTTCACCATGGAAAACTA
AAGACCAAGCATACAGAGGAGTGTTGCCCTTGGAATCAGCAGCGTTTACGTTGGCTCGGCCCGTCTCGATCAGCAACTGCGCAATCTCGAGGTTTCCCTT
ACCAACTGCGACGTGGAGCgccgtcatcttcttgttgtcgaCTGCGTCCACTTTGGCTTTGGCTCtcagaagcagcttcagcgatTCCACCTCCTCATAC
TCTGCGGCCAGATGCAGCACCGTCTGGCCCGACGAGTCCTGCACACTCAAGTCGGGTTTGCCCTTGAGCAGGGACTGAAAGATCTCTTCAAAGCTCGGGG
GCTGCTGCGCCAGTGCCAGCATGAGCGGCGTGAAGcgacgcttcttctcctgcaaaTTGAGCATAGCCCCATTGGACACGAGGTGCTGCACGATCTCCAG
TTGGTCTTCGGCTACCGCAATATGCAGCACTAAAGAAAACAGCAGTAGATTAACGGTTAATATACTGAAAGAACTGTATCTTGGACATGGGAATGTCGTA
CCAGATTCGCCCTTCTTGTTCTGATAGGCCCAGTCGCTGCGTAGCTCGATCACCTTCTCGAGGTTGCCGTTGCCTGTCATGTAGTTGGCAAGTTAAAGGC
AGTACGAACGGGATCATATAAGGTTTGGGGCAGTGCATACCGGCAGCGCGGAGTAGCTGCGCCATAGTGTCGATAAAGAGTGAGGGGGTCAAAGTCTTTA
TTGTCGATATATGGGCCAATCAGAAGAAAGTATGTAAGTTGAAATTTGAAAGTGTAAGTTTGGAATGAACTTTTGCCTGCCCTACTCGTGAAGTTGACGA
CCAAATAACTCATTCCTACAGCTGCAGATAAATTAGACATTGATACGAGGCACTGGTATCACCAACTAGAGCTGGAATTTCTGCTCCGAGCCCTTATAGG
CCGCAGCTTGGTCTTCTGTTGTCCAAAGCACTGAAGCCGGGAACGAAGCAGCGACCGTAGAAGAGTTGGACGGCGTGAGGTGGGGGGAGGGAAACTTGGG
AGGGAATGCGGCCGTGTGCAGGGGCGTGGACGAATCTCCTGCTGGAATATGGACCACTGGTGCCAGCACATGGGCACTGCTGGGGCTGGATGTCTTCTGA
GGCTCAATGTCGAGCTTCATGTTGGACACAGCAGAAGCCATGCGAACGTCACGCTCCACTTCGTGGAACATGTCCTCGGTGCTGGATAAAATTTGCAGCA
GTGTCGGGTAGCTTGAGAAAGTCGACAAGTTGACTTTGCGGCGCATATACTTGGACCGCGTGTTGTATCCTGTCATTTTGTCGTGTTTCTTCAGAATCTG
ATTCAACCGTGAAAAAAATTAGACCCTGGGTCGACAGTGAAGTAGTGAACAAATTTCATGCCGACCTTGGAAAAGCCCTGGTAATTCATGACGGCGAAGT
TCTCTAGGCGGATGCACTCACGGTAGAAGTGCACGAAGGCGAACATCAGTCGCTGCGCTTCAGACGCCTCGATCTTCTCTCGTTTCTGCAGACATGCAAC
AGTTAGACTGATTGCCAACGCAGCAAAACGGTCGGATACCCGGACAAACCTTGAGGTGCTTGAGAACAGAGCGCAACTGGTGATAACGGAAGGAGCACCG
CTTCTCTTCGGCTACGTAAAAGAGAGAGATTTTCTTGAGCTCAGCCTGCAGGTCCCGGAAGAAAGCCACCTCGAGCTGGGACTCGGCTGTCGTGGAGAAA
ATACGCTACATGATAAGCGGGGACACCATTGCAAATACGAAATAGCTAAAACCACGTACATATGTCGCGCTGGTTGGCGGCGTGGTGTGCCGCGCGAGTC
ACAGCCTTAATGCGTTTCTTGAGTATTTTGTAGTTGAGCCAGAAGGGCGCCCATTCCGGGTTGCTCTGCAGaatctcctgcagcaggcCTTTGCCGAATT
TCATAACGAGTTGTCGAGCGGAATGCCCTGCAGCGCAGCGAATGGGAAGTGATGAGCTCTGGACAGAGGGACGGGTAAGATTCAGGGTGGCCCGAGGCTA
ATGTATGGTAACCTTCAAAAGGTGTCAACACAATCTTCCGCCTTCAATGTGCCCATTTTCGGAGATTCAAAGGCCAGATCCGCGAATGAATTTCACAAAT
GTTGAAAGTGCAAAACTAGATGTATAATTACAGAACAAGACGCAAATCCTTGTTAGGGCATCGTATTGAGTCAATGCAAACCCTCGAAAACGGAGCTCTT
TTTGGAAATTCTAGAGGTTTGGTGTATGTAAAACAATTGATAAAAAAAGGGCATCGAGATTCGGAGATTCTGGTAAGACGAAGGCAATAGTGAATCCAAG
TGTCGATCGCACAACCCGCAAGAAAGCCGAGATTCGGCCTTCTCGAAAACCAAGAAGCCGCGCATTGgtcgtcaccac