Description :
From Genome Similarity Track
Location :
Scaffold_16:550564- 552775
Sequence
2211 bases(100 bases per row)
GGCTCCGATAAATTGCCTCCCCAGAAATTACTGTTAGGCTCGATGGTTCAGCAGTGGAGATCCACTCAATCTCTAGTTCGCGAATAGTTGACAAATCAAT
GCTAAGCTCTTCGATCGGAATTACACTATTCATAAAACCAATCGCTGAAACCACAACAGCAAAACAAAGCGTTCCGGTGAAGGCACTACTTGGAGTGACA
GAAAATATAACCTGCCTCGCTATATCGATATCATCATCGCGTTGGACGAGGAAATAGTAGCGTTGGTCGTCCAGCGAAGGATGATATTCAATGCCATCAC
GCTTGATGACAAGCGCATCATCTGTGGTGTTCACCGAAACAGCTAGTGTCAGATACTCGATCTCAGAATCATTGGTAGCTATCACTGGAATTGTTAGCTG
GGCAGGTGAGCCTTGGAGAACCCTTCGGCTGAAAGCGTATGGAGCTGCAAACACAGGTTGCGAAAGCGAAGGTAGCCCCGATACTACCAAGTTTTGCACA
AAGACACAACCAGACTCTGCATTGGACTCATCTTTCCAGTCAAGCATCGCATCAACCAGAAAGGATCCATATTGCATCGGTGTAAATGTGAATTTACTGG
GGTTCAAGACGATGGACGAAGCAGTAGTGTTGTACGAACTCACCTGAGCAAGATGACCATCGATTTCGAAGGTGCCAACATTCGGCAGTAAGTCGACATC
CATAACCAACGTGATGCTTGTTATGAGCTGTGAATTGTGTAGACTCACGCCGAGAATTGTTTGAGCGAACTCAGCAGGAAGAATATCGATTTTCTCTCCC
TTGCGTACCACTAGTGTGCTGCCGTTCGTTTGCGTTACCTCGCAAAAGTGAAGATCGTAGGATATCAGACTGGACGAACTGATCATCCAAGAAAGGGTAT
CATCACCTTGCCGAAGTTGAGATACAATGACATCAACAGCGAGAGTGGAAGCAACATCTTGACGCTGAGCGATTATCACTCCACTGTAGGCTCCTGTGGC
ATCATCACTAACGTCTTTCAAAAGAGCCGCGCATTCTTCGTTCGTCGATCTCGCACTTCCAGTAGTTTGAATATCCAAAACAGAACAATTCTTGATAGTG
ATGACCACGCTTGTGTTAGTCAAGACATTTGAATAATTCAACGCCAACTCCATAGATTCGCCGACCAGTGCGTTTCGCGCTCCGATAAGAATCTGGTTCA
GTACTGGTGTATCGAGCTTTGAGATCACAGTCCAACTAAGTGGTATACTGGCCGATACAAGAACAGCATCATTGGAGCTCAAAATGTCAACCTGTACCTG
TGCCTGAATGCTCTTCACGTCCGACACGAGTCGGACCAACAGAGTCTCGTTGCAGAAATGTTCAACCGTTGGGTCGTGAACATCGGACACATCTTTGGTT
CCTGTTGATGGTACTTCCATCGTCCTAATCGCATTGCTTAAAGCAAAAATCGTAAAGCTTGTAATGCAAAGAGCTGATCTCGCTTCTACCACGTTCGGAA
GAAGGTCTGCGACCAAAAGACGAAGCGGCGTATCATCTTGTAGATCGACCGTTTGAGGTAGCAACTTAACGATAACCGTATCAGGATCGAAAGTAGTCAA
TCGGCGGATATCTGGAACTCCGGCATCGGCTTCAACCTCTTCGTTATCAGTGTACATGCTTTTCAATCCACTCTTTAATTGTGAGCTGCTGGTTTCCGGA
GGTTTTGTAGATTGCAAATCGCCAGCAATGGTCACGACGAACTTCTTAGAGTATTGATTCACTTTCCCTGCCACCCTGACGCCAACTTTGATTTCAAAGT
CACTTTCGCCGACGAAAGATTGCAGTATATAAACCTTCACCAATGAACTACTTTGCAGAAATCTCCAAAACGTCACGGATTTCCCATCCACCACATTTTC
CATTGCTGAAGTGCCATCAATTTTTGCGTATTCAAACGCACTGTTGGCACTCCATAATGCTTCCATCGACACAAGATCGAGGTTGTCAATTGCACCTCGT
GCTTGCTTGATGTCTTCCAGTACATCCTTCAAGCGTACCAGCACAGGCTCATTCGGCAAAACAATCATAATATCCCCACGTGGTAACGCAACACCTAGAC
GTAAGCTCGGTGATGTAGTCCGCTGGATTCGAGAACGACTAGCTACTGTAGGAAGCATTTCGATAGAACGTGGTGCTACTTTCGGCGGATGCTTCACCTC
AGTCAAACGCC