Description :
From Genome Similarity Track
Location :
Scaffold_34:55056- 57888
Sequence
2832 bases(100 bases per row)
TCTTCCTTCTACTCAAGCTCCTCCATCTTCCTCGCCTCACCTTCAATAGGTTATGAGCTCAACGCAAGCCTCCACCGCTGACGACCGCGAGTTTCCGCGC
CTCAATGGCCGGAACTTCATCATCTGGATGACCCGCGTCACTGCCGCCCTCGAAGGAAAGAACCTTCTCGGCTACGTCGAGCGTATCGACTACACCGGTG
ACTCCGACTACGAGTTCGACTCCGATGAAGAGCTCAACCCGGCACTGTCCGACATGAACGACATGTCCGCCGCGCTTGATGCTGCCGGTGCTCCCAAGGC
CGACGAAATAGTAGGCTCCTCACCGAGCGAGTCCTCCTCTGATGCCAGCTCCGCAAGTTCGGATGCACCCACAGCCGGAGACGACGGCGATGTGGAAATG
GGGCAGGAGAATCCCCCCGTTATCCAGTCATTCACTGCTCAGAAGCGGGATGAACTGAAGCGAGCAGAGAAGCTGAAGGCTAAAAGCCAGAGGCTGAGCT
CGAAAAAGCTTCGACTCAACGAGGCAAAAGCAAAAGCTTTCCTTATCAAGACCATCGATGACCAACATGTTCTCATGGTCAAGGACAAGACTACTGCGTT
TGAGATCTTCCAGACGATCTGTAGCAAGTACGAAGGTGCTGCCATTCACGGCGACCCGTATCATGTGCTATCATACCTGATGGCACTGAGGTATGAAGAA
GGTTCAGACCTTACGGGGTTCATAATTGACATCGAATCTGCCATGAAGGTTGCCTCCGAAGCCACAAACAGTGTGCTCAGTGACGAACAGAAGTCACTCT
ACTTGTACCATGCGCTACCTGGAAAATGGAAGCAGCAACTATCGGTCTGGAAGGGTAGCAGGAAATTTATTCCCTGCGAAGAGCTAAAGCGTCACATCGA
GGCCAAGGTGCAGCATGAACTGGCGAAAAACCGCTACACGCTCAAACAAGGAACACCCGAATCGAGGGAAACTCGAAACGAGCAGGCCCTACAGGCTTTA
GCACCTGAACCAACCTTGGTTCAAGCTCCCTATCAAGAGAGCAAGGCTCTCATCTCAACGATGAGCTGTACATACTGCCTGCGCACCAATTACGATACTG
TCGACTGCTATGTTCTACAGCGCCACCTACAAAATGGTCAGGTAAAGGCAGGAACGGTGCTTCCCGCCAACTTTAAGCTGAAACCTTCGTCCAATCAAGC
TCGACAGCATCCTTACAAGGACGGTTTCGGCGGCAAGTCACGAATCCCAACAGATGGGTATTCCTCCTAGGATGCAAAGCCGTACCCGCCATTCGTAACC
AGACTCCAGATCGGCCACTCAGGAAGAATTACATCTGGAATATCCAAAGAGTCACAATAAATTCCCCGGTCGCCGCCAAGGACTCCGACTCCGACAACGA
GTATGGGATTCATAGTCATCACCACTCTGGACCTCAGACAAGAAACAGAGGCTGTAAGTCTCACCGCCCAAGATGCGGAGCATGACCCAGTGTGGACTGT
CGACTCAGGCTGCACTCGCCACGTTACGTCCAATCCGAAGTGGTTTGAGAAGCTGATCCCAAGTGCTGGCAAGTCAATCACTGTCGGCGGCAATCACCAG
ATTCCGATAAAAGGAACTGGTGATGTCAAGATGACAATCAAGGACACGAAGGGAAAGGAACGAGAAATATCCTTGGCCAACGTGCTATATGCGCCCCAGC
TGAAGTTCAACCTACTCTTCGTGCGCCAAGCCGTCGAAGATGATTTCAAAATCAACTTCCCCAACGCCAAGAAGTGCGTTCTGTTCTTCGCTAGCCGAAC
CAAATTTGAAGCCAAAATTGGTGAAGGGACTCGACTCTACCAGTTTCAAGCGATCCCGGCAACCTCAAGTCAGGTAGCCCATGTGGCCACTTCAGGTAAG
CCTGATAATGTGTTACTTTGGCATAAACGAATGGGTCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCCAACACTGTCATGGACATGGGCCTGA
AGGACTTTGATTCCAAGAAAGACTACTTTTGCTCTTCCTGCACATACGCCAAGGCCCATCGTAACCCATTCAATAAACGTACCGTTGAACGGGCAAAGTT
CCCTCTTGAAAAAGTTCATTCTGATATGGCTGGTCCATTACCCGTCCCCACACTCTCGGGGTGTCAATATTTTCTGACCTTTATAGATGACTACTCACGG
TACATGTTCATCTACATCATCAAGCGAAAGTCTGAGCTGTACGAATGCTATGAAGATTTTCGCAAGAAAGCACAAAACGTTTTTCGCGCTGATGTAGGCG
AACTCCAGTTCAATGAGAACATACACGATGAAGAAGTTAGACATCTTCAAAGCGACAATGCCCGAGAATATGAGAAACTTGGAAAAATGATTTTTCAGAA
GTACAATACGCACGCACTATTTACAAATGCGTACACGCCCCAGCAAAATGGAGTTGCAGAGAGGCGCATGCGTACACTACTCGAACGAACCAGGGCTTTC
CTCATTGATGGAAACCTACCGCAGGTTCTTTGGGGAGAATGCGTCAAACACGTTGCTGACCTTCTGAACATTACTCCCAGCTCGGTAACCGATAAGGTCA
CCCCATACGAGAAATGGTTCAAGCGAAAACCATCCGCGCACTACAGCAAAGTGTTTGGGTGTACTGCGTACGCTCACATCCCTGAGATACACCGCACAAA
ACTAGAACCACGTGCTAAGAAGTGCATGTACTTAGGACTCCCATCAAACAAAAAGGGATATAGACTCCTTGACACGAAAGAAAACCGTGTTATCTACAGC
AGGGATGTTGTGTTTAGAGAAGACGAGTTCCC