Description :
From Genome Similarity Track
Location :
Scaffold_3:550498- 551773
Transcript NameFunction/comments
Physo_127926putative polyprotein

Sequence
1275 bases(100 bases per row)
CGCTTACGACCCTCGTCGTCGAACTACACCGGATGGCAAAGCCGCTCGCGTCGCAGATGACGTGGAACGGCTTCGAATCGTCCGCGAGCATCAAAACAGG
GGCGGATGACAGACTCCTCTTCACCGAGCCAAATGCGGCTTGGTGCTCTTCGCGCCACGACCACGTGGTGTCCCACTTCAGCAGCGACGACAGTGGCTGG
ATTAACTTCGCGTAGTCCTTGGTGTACTTGTGCAAGTAGTTCGCCATGCCCTGCCACTGACGAAGCTCAGTGGGACTCGTGGGGGTCGGCCAAGAGCAGA
TTGACTCACCCTTCTCAGGGTCGGCGCGGACTCCGTCCTTGCTCGCGTAGCAGCCCAACACCGAGTTCTCCGGAGCACAGAACACGCACTTCTTCAAGTT
GGCGTAGCGCTTGTTCTCCCTCATCACCTGGAAGACTTGCTGCAGGTGCTTCACGTGGACTTCGACAGCGCTGAGGTCACTTTCGGCGCGACTGTGCACG
AAGATATCATCGAAGTAGCTCGGTGCGAAGTCACGGAGCGGGCGCAGCACATGGGAGACCATGCGGTTTAACGTGGCCGGCGCGTTCTTCAGACCTTGGG
GCATCACCAGCCACTCCCAGAGCGTGCCGCTCGGAGTGCTTATCGCTGTGAGAGGTATGTCACACTCTCGCATGAGTATCTGGTAGAACCCATCGGTCAG
ATCGATGGCGCTGTAGATCACGCTTCCCGCCATAGACTCCAGCACCATGTCCTTGCGCGGGATTGGCGCCTGCGCAGGTATGGTGGCATCGTTCAACTTG
TTGAACGCGTGAACATTGCGCCACCCGCCCGTGGCCTTCTTGACGCAAAAGGTCGGGCTGGAGTGTGGCGAGATGCTTTCGCGCACGTGACCTGCCCGGC
GGCGGCTCTCGAAGAAGTCGTCGATGGCGTTCACCTGGTCACGTGGAAGTGGCCACGCGGTACTTCGTCCCAGGCGCGAGGTCGATCTCGTGGCGCACGC
CTCGGTCCGCCGGGAGCTCAGCGGGGATGTTGTCGGGGAAGATGTCCGCGTACTCGCGGGCAGTTTCGTACACGGGGTTACCGGACTCACGCAGAGCTTC
CCAGGACTGCGCCGCGAAGCGCTCCTCGCGCGCTGACTTGGGCTCGGCGTTCTTGGGCCTCCACGGCGTATCCTCAACCTCGACCGTGTTCAGCGTATCC
ACCGGGACCGCCTCGGTGGTCAGACACACTTGCTCGATCTCACCTGCATTCAGGTCTCGCAGGAAGTTCTTCCAG