Description :
From Genome Similarity Track
Location :
contig_22:550477- 553365
Transcript NameFunction/comments
g5687.t1hypothetical protein
g5688.t1hypothetical protein

Sequence
2888 bases(100 bases per row)
GGTAGGTCCGAAGACGGTGCATGTTCAACCAAAGACCCGTTCCCCGTCACAGCCTTCTGGGCGCAAGATTCGTTCTAAGCCGGCACTGGAATCGAGTCCG
GCATCATTGACTCTATCGGAGGTTGCAATTCCGCAAGCCACTTCTGCCTCTTTGCCAACGACTCCTCGGTCAACTGTTAGCACGTCATCTGTGGCGTCCA
CCATTGTTTTATCGTCGGCTCCGTCGTCTTCATCCAGTGTAATCTCCACTCATGCAGCGGAGGCCCCAGCTTCTCGGACATCTCGTCGCCGCTCGACTCG
TGCTGCCGCCGCCTTATCTCGTCAGAGCTCGGCAAGTGTAATTGCGCAGGAGGCGGTAGATAACGACTTCATTCTTGGATTTGACACTCCGGTCTCAAGC
CACCGGGTAGTCCGGAGTCGGCTGCTTCTCGACCGCGTCACAGTGAGATCTCGGGGAGGAGAAGAGGGTGGACAATCGACAGAAGTGGAGCTTGGAGCAG
TGGAGCTGGGGCGGACTCTCACAAACACCCGCCCGTTCGGCCATCTGCTGGAGGTTCCCGTGCGCCATACACTCCTGTTCCAATGTCTGCTCTAGACCCG
GTTGCAGTCAGGCGTGATCACCGTCCTGTACGGCCGCACACCGTTGTCTTGGCAACTTTGTCAACGACACCTGGCACCAACCCGAATGCAGCGACTCCGG
TAGCGAGCCTTCCTCCAGCAATTCGAGGGTGGCAACCTCTCGTGAGGCCTTCACGAAAACTCGTTGGCTGGGCCTATGACTTCTTGGAGCCTGGTTTCCG
CTTGAAAGGATCTCAAATGTGCTGGAACCAGATCATTAATTACCGGACACTAACGCCGATTGGCGATCTCGTTACGCTTTGTTCCGCAGAGGGTATTAAA
GCCTTTGCAGACTGGAAGCGGCCTGATCATCCGTGGCGACAAGTCCAGCGAAAGATGCCAGACCACGCGTGCTTATTTGACGTGGAACCGTTCATGCCTG
ATGTCCACATCTCGATTCGAGGACCAAAGACGCACCGCACGGTCAAGCTTTGGCCACTACGTTCGTCCCGTGCAACCCCTCGGTCGAGCTATTCGTGCCT
CGGGGAATGACGGACGTTGAGGTTGGTCGTGCTGTGGTGGTGAACCCCGAGCTCTCGGATGCTGACATTCACCCTGGTTGGCATGAGATGGTCGAGACGT
GGTCTAAGGAAGGTGAGTCTGGCAGCGAGGATTCGGTTCCGGTTCCAGAAGACCCTGCGTTTAAGGCTTCTGCTGATCCTAGCCTTCACGGGCTTGTAGT
CGGGACCGTGACGACCATCTAAGTCTCGGTCGTCATCTCGCAAGTGTCGTCACGTGTTCTTCAAGCGCATCCAGTGTGAGCCGTAGCGTCTTAGTGTAGT
TGGTGCACCTTGGAGCTTCTTCTTCTTTCTTAATGCTTCATTCCGGATCTCCATTGTTCGTTCACAAATTCATCAAATGCAATATGTAGTCTGCTGCAGT
AGCTGTTTTCGTCTGTAGTCTTGGGCTGCATTGCCCCAAGTACAGGTCATCATGATGACAACAAATGTTGTCTAGTCCTCGTCAGCGACTTGGACCATCT
GCAAGCGCTGTTCACGCTTTTTTCGCTGCAAGTAATCATACAACATGCCCCCGCACGAGAGGTTCGATATGGGTTCCCATGTTGGCTCGTCCTGATCAGC
CCATTTGATCTTAAACTCTCTGATCGATCGCGCAGTCCTCGTTGACATGGGCATTCGATCGTCGAGGATCTCCAGGACCTCGCTTTCACCAGCCAGCCGG
TCAGGCTCCCAGCTATCTTCGGGCAGGAGTTCTTCATCAAAGTCGAAACGTGAATCCTCAGTCACATCCTGCGTCAACCGAGTCCTCGGTCGGTCCTCGA
ACTCGCTTACTGCCTTCAGGCGTGACACATGAACCACTGGATAGAAACGATATCCACTCCGATCGGGCAGTTCCAGCTCGTAGGCGTATTCTTCCACCTT
GTTCTTTACCCTGAACGGGCCGTGCCATCGGTGGGCAAGCTTCTTAGTCAATCCGGGCTTGACGCGCTCCATATACAGCCAGACACGGCTTCCTGGTTCG
AAGAGAGACTTCGTCACTGCTTCAGTATGTTCGTCGTCTGTTCGTTCGCCATTTGGATGGTTCCGGCGTCTCATCGTTCGATCGTCGAGGTACAGCTGCC
TGTTCTTTTCGACTTAAGGCTTCGTTATGTTCCTTGGCTCGACGCGTCTTTTCTGCTGCTTGGTACTCCTTGGCCATTTCAAGCGCTATTCCTTGCTGGC
GATTCACCTCTCTTCGCCATGCTAATGCATCAGATTGCTTACCGGAACCTCGTCGTAGTGAAGACGTCATTGCATGCAGCGACGAGTGAGCGTCCCACCC
ATGTACTAGGAAGAACGGGGTCTCCTTTCGCGTCGTATCTTGCGAATTGTTGATTGCGAACACTAATCGCTCTGCAATCTCGTCCCAGTCCTGCTGCAGC
GGATCTTCGACGTACACTTTCACTGACTGCATGACGGTCTTTACTGATCGCTCTTGTTGGCCATTAGCTTGCGGTCGATAGCTTAAAGTCGCTCTCGATC
TCGATTGCATCATATCAGCAAAGGCTTGAAAGACCTAGCTCATAAAACGAGGATCCCTGTCGTGCCGAATAAGTGCAGGTGCACCGAAACGTCGGTATAT
GCATTCTTCGAAAGCTTGGGCCACCATGAGAGCGGACGTGTCCGACATAGCTTTGGCAACCACGAATCCAGTGAACGAGCACTGGAACAGTAGTAGCGCA
GTGTTACCGCGTCGAGACTTCGGCAAGGGTATGACGAAGTCCATTGACACGATCTGGAATGGTCGTTCGGCTAGGATATTGCCTGGAG