Description :
From Genome Similarity Track
Location :
contig_22:550429- 553317
Transcript NameFunction/comments
g5971.t1hypothetical protein
g5972.t1hypothetical protein

Sequence
2888 bases(100 bases per row)
TAGGTCCGAAGACGGTGCATGTTCAACCGAAGATCCGTTCCCCGTCACAGCCTTCTGGGCGCAAGATTCGATCTAAGTCGGCACTGGAATCGAGTCCGGC
ATCATTGACTCTATCGGAGGTTGCAGTTCCGCAAGCCACTTCTGCCTCTTTGCCAACGACTCCTCGGTCAACTGTTAGCACGTCATCTGTGGCGTCCACC
ATTGTTTTATCGTCGGCTCCGTCGTCTCCATCCAGTGTAATTTCCACTCATGCAGCGGAGGCCCCAGCTTCTCGGACATCTCGTCGCCGCTCGACTCGTG
CTGCCGCCGCCTTATCTCGTCAGAGATCGGCAAGTGTAATTGCGCAGGAGGTGGTGGATAACGACTTCATTCTTGGATTTGGCACTCCGGTCTCAAGCCC
ACCGGGTAGTCCTTAGTCGGCTGCTTCTCGACCGCGTCCCAGTGAGATCTCGGGGGAGGAGAAAGAGGGTGGACAATCGACAGAAGTGGAGCTTGGAGCA
GTGGAGCTGGGGGCGGACTCTCACAAACACCCGCCCGTTCGGCCATCTGCTGGAGGTTCCCGTGCGCCATACACTCCTGTTCCAATGACTGCTCTAGACC
CGGTTGCAGTCAGGCGTGCTCACCGTCCTGTACGGCCGCACACCGTTGTCTTGGCAACTTTGTCAACGACACCTGGCACCAACCCGAATGCAGCGACTCC
GGTAGCGAGCCTTCCTCCAGCAATTCGAGGGTGGCAACCTCTCGTGAGGCCTTCACGAAAACTCGTTGGCTGGGCCTATGACTTCTTGGAGCCTGGTTTC
CGCTTGAAAGGATCTCAAATGTGCTGGAACCAGATCATTAATTACCGGACACTAACGCCGATTGGCGATCTCGTTACGCTTTGTTCCGCAGAGGGTATTA
AAGCCTTTGCAGACTGGAAGCGGCCTGATCATCCGTGGCGACAAGTCCAGCGAAAGATGCCAGACCACGCGTGCTTATTTGACGTGGAACCGTTCATGCC
TGATGTCCACATCTCGATTCGAGGACCAAAGACGCACCGCACGGTCAAGCTTTGGCCACTACGTTCGTCCCGTGCAACCCCTCGGTCGAGCTATTCGTGC
CTCGGGGAATGACGGACGTTGAGGTTGGTCGTGCTGTGGTGGTGAACCCCGAGCTCTCGGATGCTGACATTCACCCTGGTTGGCATGAGATGGTCGAGAC
GTGGTCTAAGGAAGGTGAGTCTGGCAGCGAGGATTCGGTTCCGGTTCCAGAAGACCCTGCGTTTAAGGCTTCTGCTGATCCTAGCCTTCACGGGCTTGTA
GTCGGGACCGTGACGACCATCTAAGTCTCGGTCGTCATCTCGCAAGTGTCGTCACGTGTTCTTCAAGCGCATCCAGTGTGAGCCGTAGCGTCTTAGTGTA
GTTGGTGCACCTTGGAGCTTCTTCTTCTTTCTTAATGCTTCATTCCGGATCTCCATTGTTCGTTCACAAATTCATCAAATGCAATATGTAGTCTGCTGCA
GTAGCTGTTTTCGTCTGTAGTCTTGGGCTGCATTGCCCCAAGTACAGGTCATCATGATGACAACAAATGTTGTCTAGTCCTCGTCAGCGACTTGGACCAT
CTGCAAGCGCTGTTCACGCTTTTTTCGCTGCAAGTAATCATACAACATGCCCCCGCACGAGAGGTTCGATATGGGTTCCCATGTTGGCTCGTCCTGATCA
GCCCATTTGATCTTAAACTCTCTGATCGATCGCGCAGTCCTCGTTGACATGGGCATTCGATCGTCGAGGATCTCCAGGACCTCGCTTTCACCAGCCAGCC
GGTCAGGCTCCCAGCTATCTTCGGGCAGGAGTTCTTCATCAAAGTCGAAACGTGAATCCTCAGTCACATCCTGCGTCAACCGAGTCCTCGGTCGGTCCTC
GAACTCGCTTACTGCCTTCAGGCGTGACACATGAACCACTGGATAGAAACGATATCCACTCCGATCGGGCAGTTCCAGCTCGTAGGCGTATTCTTCCACC
TTGTTCTTTACCCTGAACGGGCCGTGCCATCGGTGGGCAAGCTTCTTAGTCAATCCGGGCTTGACGCGCTCCATATACAGCCAGACACGGCTTCCTGGTT
CGAAGAGAGACTTCGTCACTGCTTCAGTATGTTCGTCGTCTGTTCGTTCGCCATTTGGATGGTTCCGGCGTCTCATCGTTCGATCGTCGAGGTACAGCTG
CCTGTTCTTTTCGACTTAAGGCTTCGTTATGTTCCTTGGCTCGACGCGTCTTTTCTGCTGCTTGGTACTCCTTGGCCATTTCAAGCGCTATTCCTTGCTG
GCGATTCACCTCTCTTCGCCATGCTAATGCATCAGATTGCTTACCGGAACCTCGTCGTAGTGAAGACGTCATTGCATGCAGCGACGAGTGAGCGTCCCAC
CCATGTACTAGGAAGAACGGGGTCTCCTTTCGCGTCGTATCTTGCGAATTGTTGATTGCGAACACTAATCGCTCTGCAATCTCGTCCCAGTCCTGCTGCA
GCGGATCTTCGACGTACACTTTCACTGACTGCATGACGGTCTTTACTGATCGCTCTTGTTGGCCATTAGCTTGCGGTCGATAGCTTAAAGTCGCTCTCGA
TCTCGATTGCATCATATCAGCAAAGGCTTGAAAGACCTAGCTCATAAAACGAGGATCCCTGTCGTGCCGAATAAGTGCAGGTGCACCGAAACGTCGGTAT
ATGCATTCTTCGAAAGCTTGGGCCACCATGAGAGCGGACGTGTCCGACATAGCTTTGGCAACCACGAATCCAGTGAACGAGCACTGGAACAGTAGTAGCG
CAGTGTTACCGCGTCGAGACTTCGGCAAGGGTATGACGAAGTCCATTGACACGATCTGGAATGGTCGTTCGGCTAGGATATTGCCTGG