Description :
From Genome Similarity Track
Location :
scaffold_595:5504- 6548
Transcript NameFunction/comments
Pl_103568hypothetical protein PHYSODRAFT_488998

Sequence
1044 bases(100 bases per row)
GCCGCTGCCTTCTTTTGCGCTCGTTGTGCATCGATACGGCCCTGTACAATCGCAGTGAAATCTGTCATGTAGGCTGCTACGACGTCCAGATCAATCATAG
CACGTTGTCCATGATGAGTCACATCTGCCTCTGAGATTCCGCTTGCTGTTTTTCCACGAGAAGTATGTGCTGATGTAGCGGAGGAACCAGAAGGTCCGTT
AGCGCCAGAGTTGTCGTGACTGTCATTGCCAGATTGATTGGTACTTCCTTGAGCATGATAACTGCCTTCGACATGTTTGAGGATTTGTCCGTGAATACCA
CTAGTACATCGCTGCAGCAGATTTCCGATAGCCATGATGATCTGGCCCAATGCTAGTGTTTTCTGTGTCGTGGCTCGAAGAGTTGCGTCGGTCTCGTGCT
GCAGACGCACACCAAGTAATTCTTCTCGCTCGAGAGCGCGTTGCAGCGCTGCAATGCGGTTGTTGAAGGTGAGAATCTCATTGGCACGTTCCTTCTGGAA
GGCAGCAAACTCCAGTCGCTTGGACTCACTCTCTTCTTCATGTGTGATTTGATTCCGACTAAGGTCTCGATTGGTTTCGCGCAAGGTGTGATAGCGGTTG
ACAAGATCGCTCACTTCGGGGTAGTCTTCTGGCACGGCTTCCTGTACGAGCTCCAAGTAGCGAGTATACTTGAGATGATGACGAACCTGTGCTCCCAGTG
CGTCACTCTCGCGCTGGAGCGCAGCTAGCTGCGTCTGCAGCCTCGCCACCTCCTGCTCCTTGCTCACGCGCTGTTTGACCTCATCGCTGGCTCGCTTGAC
TGCTCGGTTACGTTTGGACTCGTTCTCCTGCAGGAACTTGTTGAACTTGATGAGCGATTCCTGCAACTCGAGATCTTTCTTGCGTAGTCCCTCTTCGCGG
CGGTGGAAGGCGTCTTCACGGCGAGCGAATTCCTCTTTCTGAGCATCCAGTGCTTCCTGCACCTCAAACATTTGTCGACGTTTTTCCAGCAACCTCGTTG
CCGGAGAAACGTGGTCTAGCGTCAGAGTCTGTGGCATCTTTGAT