Description :
From Genome Similarity Track
Location :
Scaffold_34:55034- 59751
Sequence
4717 bases(100 bases per row)
AAATTCAATCACATCTCTTTTTTCTTCCTTCTACTCAAGCTCCTCCATCTTCCTCGCCTCACCTTCAATAGGTTATGAGCTCAACGCAAGCCTCCACCGC
TGACGACCGCGAGTTTCCGCGCCTCAATGGCCGGAACTTCATCATCTGGATGACCCGCGTCACTGCCGCCCTCGAAGGAAAGAACCTTCTCGGCTACGTC
GAGCGTATCGACTACACCGGTGACTCCGACTACGAGTTCGACTCCGATGAAGAGCTCAACCCGGCACTGTCCGACATGAACGACATGTCCGCCGCGCTTG
ATGCTGCCGGTGCTCCCAAGGCCGACGAAATAGTAGGCTCCTCACCGAGCGAGTCCTCCTCTGATGCCAGCTCCGCAAGTTCGGATGCACCCACAGCCGG
AGACGACGGCGATGTGGAAATGGGGCAGGAGAATCCCCCCGTTATCCAGTCATTCACTGCTCAGAAGCGGGATGAACTGAAGCGAGCAGAGAAGCTGAAG
GCTAAAAGCCAGAGGCTGAGCTCGAAAAAGCTTCGACTCAACGAGGCAAAAGCAAAAGCTTTCCTTATCAAGACCATCGATGACCAACATGTTCTCATGG
TCAAGGACAAGACTACTGCGTTTGAGATCTTCCAGACGATCTGTAGCAAGTACGAAGGTGCTGCCATTCACGGCGACCCGTATCATGTGCTATCATACCT
GATGGCACTGAGGTATGAAGAAGGTTCAGACCTTACGGGGTTCATAATTGACATCGAATCTGCCATGAAGGTTGCCTCCGAAGCCACAAACAGTGTGCTC
AGTGACGAACAGAAGTCACTCTACTTGTACCATGCGCTACCTGGAAAATGGAAGCAGCAACTATCGGTCTGGAAGGGTAGCAGGAAATTTATTCCCTGCG
AAGAGCTAAAGCGTCACATCGAGGCCAAGGTGCAGCATGAACTGGCGAAAAACCGCTACACGCTCAAACAAGGAACACCCGAATCGAGGGAAACTCGAAA
CGAGCAGGCCCTACAGGCTTTAGCACCTGAACCAACCTTGGTTCAAGCTCCCTATCAAGAGAGCAAGGCTCTCATCTCAACGATGAGCTGTACATACTGC
CTGCGCACCAATTACGATACTGTCGACTGCTATGTTCTACAGCGCCACCTACAAAATGGTCAGGTAAAGGCAGGAACGGTGCTTCCCGCCAACTTTAAGC
TGAAACCTTCGTCCAATCAAGCTCGACAGCATCCTTACAAGGACGGTTTCGGCGGCAAGTCACGAATCCCAACAGATGGGTATTCCTCCTAGGATGCAAA
GCCGTACCCGCCATTCGTAACCAGACTCCAGATCGGCCACTCAGGAAGAATTACATCTGGAATATCCAAAGAGTCACAATAAATTCCCCGGTCGCCGCCA
AGGACTCCGACTCCGACAACGAGTATGGGATTCATAGTCATCACCACTCTGGACCTCAGACAAGAAACAGAGGCTGTAAGTCTCACCGCCCAAGATGCGG
AGCATGACCCAGTGTGGACTGTCGACTCAGGCTGCACTCGCCACGTTACGTCCAATCCGAAGTGGTTTGAGAAGCTGATCCCAAGTGCTGGCAAGTCAAT
CACTGTCGGCGGCAATCACCAGATTCCGATAAAAGGAACTGGTGATGTCAAGATGACAATCAAGGACACGAAGGGAAAGGAACGAGAAATATCCTTGGCC
AACGTGCTATATGCGCCCCAGCTGAAGTTCAACCTACTCTTCGTGCGCCAAGCCGTCGAAGATGATTTCAAAATCAACTTCCCCAACGCCAAGAAGTGCG
TTCTGTTCTTCGCTAGCCGAACCAAATTTGAAGCCAAAATTGGTGAAGGGACTCGACTCTACCAGTTTCAAGCGATCCCGGCAACCTCAAGTCAGGTAGC
CCATGTGGCCACTTCAGGTAAGCCTGATAATGTGTTACTTTGGCATAAACGAATGGGTCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCCAAC
ACTGTCATGGACATGGGCCTGAAGGACTTTGATTCCAAGAAAGACTACTTTTGCTCTTCCTGCACATACGCCAAGGCCCATCGTAACCCATTCAATAAAC
GTACCGTTGAACGGGCAAAGTTCCCTCTTGAAAAAGTTCATTCTGATATGGCTGGTCCATTACCCGTCCCCACACTCTCGGGGTGTCAATATTTTCTGAC
CTTTATAGATGACTACTCACGGTACATGTTCATCTACATCATCAAGCGAAAGTCTGAGCTGTACGAATGCTATGAAGATTTTCGCAAGAAAGCACAAAAC
GTTTTTCGCGCTGATGTAGGCGAACTCCAGTTCAATGAGAACATACACGATGAAGAAGTTAGACATCTTCAAAGCGACAATGCCCGAGAATATGAGAAAC
TTGGAAAAATGATTTTTCAGAAGTACAATACGCACGCACTATTTACAAATGCGTACACGCCCCAGCAAAATGGAGTTGCAGAGAGGCGCATGCGTACACT
ACTCGAACGAACCAGGGCTTTCCTCATTGATGGAAACCTACCGCAGGTTCTTTGGGGAGAATGCGTCAAACACGTTGCTGACCTTCTGAACATTACTCCC
AGCTCGGTAACCGATAAGGTCACCCCATACGAGAAATGGTTCAAGCGAAAACCATCCGCGCACTACAGCAAAGTGTTTGGGTGTACTGCGTACGCTCACA
TCCCTGAGATACACCGCACAAAACTAGAACCACGTGCTAAGAAGTGCATGTACTTAGGACTCCCATCAAACAAAAAGGGATATAGACTCCTTGACACGAA
AGAAAACCGTGTTATCTACAGCAGGGATGTTGTGTTTAGAGAAGACGAGTTCCCACACTTGGAATTCCTCAATACACCAGCAATCTCGGTCCAAAATGGC
CCCGCACCGACGCTATCACCGTCGCTACCAACACCACAATTGCTACCTCCAATAGCCTCACTACTAAAACGCAGCGTCAATGCGCTTGCCGCGGAAGTAG
TAGTAAAGATGAAGAAAGTCAAACACAAAACGAACGCTCAGAACGAGGATGAACACTCGTGTCTACTTGATGATCCACTCGACATTAACGAACGAAAAGA
GCACCTCACTCATATCTACGCTCTATTGGCTATCAGACACATATCTGAACCAAAGACGTTCCTAAAATCCCAGAAACTACCAGAAGCACAACACTGGGAG
AAGGCAGCCATTTGTGAATACAAATCATTGATTGACAACAAAACGTGGGTCCTCACAAAACTACCGATAGGGAGAAGGGCCCTACAGTGTCGATGGGTAT
TCGTTGTAAAATACAATGGAGACGGCAGTATTGAGCGCTATAAAGCCCGCCTGGTAATAAAAGGTTTTTTGCAAAAGTATGGCGTTGACTACGATGAGAT
ATTCTCTCCAGTGATCCGCATGGAAGTGCTGCGACTTTTACTGACGATTGCAGCACTCCTTGACCTTGAGATCCATCAAATGGATGTTAAAACCGCTTTC
CTGAACGGATACCTCGATGAGGAAATTTACATGCTGCAACCTGAAGGGTTTACTGTTCGTGGAAAAGAGCACTTAGTCTGCAAGCTTTTGAAGAGCCTAT
ATGGTCTCAAGCAGGGCACCTCGGATCTGGTATCTTACCTGTGCTCTTTTCTTCTCACCATGAAATTCCACAAACTCATCAAAGACCAATGCGTTTTCAT
TGGAGTTGTGGATGGAGCTACATGCTACATTCTAGTCTATGTGGACGACCTCCTCATCATAGCCACTACGCTTGATATCATTAACAACATAAAGAACGCT
CTCAAGCAGCGCTTCAAAATGTCTGATCTCGGTGAAGCTCAATACATCTTAGGCTGGTCAATCATACGCAACCGTACGGACCGAACCATTTTCATCCACC
AAGAGAAGTACGCTACCAAAGTCCTGGATCGCTTCTCTCATCTTGATGCACACCCGGTTGGTACACCCGCTGATCCCAGTGTGAAGCTGACGGAGGCCAT
GTGCCCCCAAACGCCAGAAGAAAAACATGAGATGAAAGCGATCCCGTACAGAGAGGCAGTTGGTAGCTTCATGTACTTAATGATGGGAACTAGACCTGAT
CTCGCATATTTTCTACGAGAAGTCAGTCAATTCCTGGTGAACCCAGGAAAACCTCACTGGAATGCTGTTAAGAGAGGATTGAAGTACTTAAACGGTACGC
GCAATCTTGGCATCACCCTTGGTGGAAAGCAAAATCTAGAGCAGTATAAGTCAAAGCATTATCTCACTGCATACTCCGACGCAGACTACGCCAATTGCCC
AGACACACGACGATCTGTGGGAGGCTATATCGCATATATGTGTGGAAGCCCAATTTCATGGCAATCGAGAAAGCACCACACCGTAGTTCTGTCCACAACA
GAGGCAGAATACATAGCCCTATGTAACTGCATGCAAGAAGTTATTTTCTTAAAGCTTCTTTTAGTAGAGCTTAAACACGAAAGCTCACATGCTATTACCC
TATTTGAGGACAATCAAAGTTGTATTAAACTTTCCTACAACCCAGAACTGCATGGCAGAAGCAAGCACATTGACATTCGGTATCACTTTGTACAAGAAAA
AGTAGAGCGAAAAGAATTTGAAATTATGTACTGCAACACCAAAGAAATGGTAGCAGACATTTTTACAAAAGCACTATCAAAACCCCTTTTTATAAATCTA
AGAGGGTCACTATGTAA