Description :
From Genome Similarity Track
Location :
Scaffold_1:5503054- 5516966
Transcript NameFunction/comments
Physo_469486Hypothetical protein
Physo_428394protein kinase putative
Physo_295407translation initiation factor IF-2
Physo_476737Hypothetical protein

Sequence
13912 bases(100 bases per row)
AAGTGGAGTGCATCCACCATTTTTTGATCGTTGGTTTGTTAGCTAGGAGTTGATGTTCTCGTATACTTGAGAAATGCACCTCTGGCGTTCATTCGCGCAG
TGTAGGGGTCCGTGGGCAGTGGCTTGTCATCACAACTGGAGACGATGGTGTCAAAGCGACGACGAAGTACTTCAACCTCTTCCAAGGCTGAGAATTCATT
GTCTCCGAGCTCCTTCTCGATCTGTTGAGACTCATCGAGCGAATCCTGAGCGGCGCGCATGTTTCGAGCGACCTTGATTCCTGAGCCACAAGACGGGTGC
GAGGGTGTGATCGCAGCTTTGAGCTGCTCTCCAAGTCGGCAGTCGCGCACGAATTCATCGCGCCGCGCAATAGCATCGCGCTCAGCCTGTTCTTCACGAC
GCTCCTGGCGCTGCTTCTGCTCCTCATCCGGCTCACCTTCGTCTCGTGCTGAGCGCGGATCCGGCTTCACCTTCAGTTGATAGCGCCGCTGCAGTGCTTT
GAGTGAGAGAGCAAGATACACGCACGCAGACGCGCGGATTGACATCTGTGGGAACTTCGGACGTTCGCTTCCGAGTCCAAGCAAGACCTCGTTGAGTGCT
GCTCCAAGCTGCTGCTCTAACTGCCCCGGGTAGCTTTTTGCCAGCGTCACCTGCGGTGGGAGCTTTACTGGCAGACTCTGCGATGTGTATCGCGATGGCT
CGGTGCAAAACTTACGGCGTGCTTCCTCAGAGACGAAGAAGTACACTTTCGAGCGGTATGACGCGCGATAGAAGACGCTGCCGTGGCGTAGTGACGCCCA
ATCCTTCTCCCCGGAGCCCATCGCAAAAGTGACTGGGCAGTAGCCTTTCATCTCGGGGAAGTCGCAATCAGCCACGGTCAGCAGGCTTAGCAACGAAGCG
TTAACTGGGGCCCTTGCGACCAGAGCCTGCGCCTCGCTCTCCGCTTCGTCCTGCGAAGGCCAAGGATCGTCTCCCTGTTGAACTGGAAGTTGGCCTGGTA
AACACCCGACGGAAGCTTCAGGGCTCGCGAGGAACTGCTCGAGATTTTGCTGGTTCCCAAGCCAGAAGCTAGAGCCACGGAAATCCACACACAACTCCCG
GTTTGATTGGCGAGAATGGTAAAATCTTCCAGCGCGCAGCTCAACCGGACAGAACGTCTGGAAAACAGGATGCTGTCGCGCTTGAAGCGCTTCACGGGAG
CGCACAACACCTAACGATCGGGCTGCTCGGTCGGAAGCCATTGCCCTTGCGTGGTGTGCTACCAACCGCTGCTGCTCTTCGAGAAATGCTTGCGCCTGAG
CGGCTACGTGCCAGAGCGAGTGGCTTGAACTATCAAGTTGGCGCACGTGGAAACTACCAAAGCGTCGAGTCCAGACGTCAAGCAGCTTTGGCCAATACTG
ATACCACCGTGAAAATGCCGCTCGAAGATCATTTTTCTCAACATTTCCCTGATGATCCTGCCAAACACTTGCGAAGCCGCGCTCCAGAACGAAAAGCATG
TCTGGTTGAATGGTCGAGTCGACTTCTGTTGTACTTGGATGTGGAAGACTGTGCTGTAGCTCATGATGCTGCAATAGATACCCGTCGAGGACCCAACCAC
GCGCTTGACACTCTGAGGAGCGTAAACGAGTGCAAATGGACTCGTGAGTGAGATCGTTGTCGGATAAAGGGCTTCTTTGCTGTTGTTCCGTGATCTCCTG
TAGTCGACGACGAAGTGCAGACCCACCCTGGCATTGCAGCACCCACTCCACAGCATTTTGGGGAGATACATACACCAGTCCGAGAGCATTCGCAAGTTCT
TGGGCGACGCGTGTTTTACCTGCGAATGGAGCCCCCACTACGCAGCAGGTCAACTGGTGTCTTGGGGGAAGGCTAGCTTTCTCCAAGTAACGCGAGGGAC
AAGCCATGAAAGCTCGACGGGCTTCACGCGACCGAGGAAAGTAAATTTGACCCCGATGCACTACAGCCTTGACTGACGCGGCCGATAACGAGTCTGTCCG
TCCTGTTACTGGGCACGCAAGGCCATGTTTGCCGATGAGAAGTTCACCTGATGCTAGCATCTTTTGCATTGCGCCTCCCGCCGACATGTCAAGCACCTCG
CAATGCTCGAAAAGCGTCTCTCGACCTGCCATGAAATCGTTCAGAATTCGTCTCACGTGCTTGGTTGTTTGTCTTGGTGATCCGGTCGCATCCACCGGGT
TACAGACTTTGACTCCTCGAGCTCTAAACGCAGCGATAGCTTCCTCCAGAGCCTTTTGATCTTCGGTATACTGTTCACGCAGCCGCGTACTCTCCTCTTC
TCGTGCAGCCTCCATGTCTATCGGTGGTTCTTCTTCTTCGCCTTCGTCTGGAGGATTCCCCTCGCCTTCTGCATCGTCAGCAGACTGTATTTTACGCGTA
AGAGCAAGTTTCCGACGCGGTGGCGGCAAGCTGGTAGCCCACCGACTCAACAAAGAGTTCACGACGTCGTCTTCTGACATTGACAAGGGAATCACAAGTG
TTGGGAATAGTCCGAGCTTGAAACATATCTCCAGAGTCGACGCAGTTGGGATGCGTGAAGCTTCTGGCCCCAATCCAGCAATGATCTGTGCGACCGCTTT
CTCGGACGTTGGCTGTCGACGATGAAGCTCTCGTTGAAGCGCTCTGATGGACACTTCTTCCTGCGCCAATCGTGCTTCTTCCGGCTTGAGCTCTTCTAGC
AGCTGGTTGCGTTCAGCCTCCGTTGAAACAGCGGCTAGATCCACATTCATGAACTCCGTTGCCGTGTTACCTGGCTCTGTTTCCGTTTGGGCGAGTGCTG
CAGCGATGCGACCGCGTCCCGATCCTCGAACTCCGAGCAGCAACACGCACGGTATGAAGTTTGAGGTTGCACGAGGTCCTGTAGGAATGAAGGCCGACGG
ATTTCCCTCAAACGCGTGGCGCTCCGATTCACCAGCGAAAGCGTAAAATTTCTGCCTGAAGCAGCAAACGTGAGATGGAAGACCAGGTATCAGCAGGCCA
CGCGTACTCCAAGACACCGGGCAAAACCGTCCACATTCTCCCTGAAGCTGTAGTGCTCGGCTTCTTGCTGCTTCAGCTTGCGCTTCCGCCTCAGGATCCG
TGACATCACTCTCAGCTTCTCCTTCTTGCGGCGGACGACTATATGGCTCTTCATCCTGATCACGAAGTGGTGGAGCGAATAGCACAGCGGGATCGTACTC
ATCAACGAGCTGTGGAGCCTGTCCGTCCTCGACACTATCCAAACGCGGTGCAAGTGGGTTTATCTCGCGCTCGATGGCTGCCAGGGTGTCGCTGGGTTGC
TGAAATAGTGGGCAGTTTATCACGCGAGGGGTGCCACCAAGTCCTTGTGATACGTCTTCAGCGCCAGCCTTTTCGGCCTGGAACTGCTGCCGCCGTAGCG
CAGATAGTGCACTAACTGCATCAGTATCGGCACCGCCTTCCTCTTGAGACTCTCTATTCATCACTAAAATCGCGTCGGGCACGCATCCGTGCTCCAGCAG
AACTGCAGCGACGTCACGAGTTAGTGGCAGGTCCATGATCATCCACCCAGAAAATGCATTCAATTTGGGCAGCAGGGCTTTGACAGCTTCGGAGGCTGCT
GTTGCAGCTTCAGTGGAGGAGACAACCTGTCCCCTCATAAGGCGCATTTCCATGGATATGCTGGGGGAAATCTTGAGCAGCTTTGATGCAGACACAGTCT
GAACATTCAGCCCAGTCTCCAGTGCCTCCAAGTACGCAGGCGTAAGAATTTCACCTACACCAGTATTGACTAGCCAAAAGTTGCGATACGTTGATAGAGC
TGGGAACTCTCGGCGCAAAAACTGGAGCGGGTGTGAGCAAAAAGCTCTTCTGGCATCTGATGAGGCCAACAAATAGACTCGACCAGAGTAACAGGCTGTA
TACTCAGGATCACCGGGTGTTAGTGCGGTGCCAGAACTTGTCACGGGGCAAAACTCACGCCACTTTGACAGCAGTCGGCGCTTAGCATCACGTCTGGGCA
ACATGGAAAATGTTTCAGTCGTAGAGCTGGGTTCGGCTTCATGCAGCGCAGACCAGTCTCCATAAAGCAGCCACCTGATCTTCTCAGCACGGCTGGATCC
GCTTAGATCTTCAGGCAACAACACCGCGTAGGCCTCACGGGAAGTGCTGAACCGGGATAAACCCAATGATGTCTGCAACAAGCACGGAAATGTGTGCATA
AGGTAAGAAGCTAACATAAATCTACTGAGTGCAATGATACTTACGCCCGTAATCGCTTGGATGCAGTGATCTCGGATGACATTAAGGGACTGAACCGCAA
GCACAGCTACCAAATGGTAGCCAGAAGGGTTGTTCGACGTGGTAGCAGCTCGGTACATCGCCAACTCGTTCTCCATTCGCGTCACATACCCACGAAAATG
TTTGAAAAGCTTCGCCAAAGTAATCGAGCCAAACGGCAAAGAAGCTTCTGTGGGTGGCTCAATCTCGTTGCGTTCGGCAGGAGTCGGCTCCGGTGGTGGC
ACAGGCTCTTCGGGAATAACTTGGTCACCATCTTCCGGGTCAGTCTCTTCGGTAGCGCCTTCTTCGGGTTCTCCCTCTTCGGTAATGCCTCCCTTTTCAG
CGGGAGCATTCGTCTCCTGTGACTCCTCTGCTTGCAGCTCTACCTTCTTCGGTGGCAAGAGAAAATCTGCGAATCCTCGCGTAGCTAATTCTTCGGGGTT
TGTCGACTGTAGGAGAGCAAGCTCTCGCGCTGAGTATAAACGACCGGCGGTCGGTGTCAGCTCTGACCCTCTGAGTTGATACTCGAGCTCATTGGGTAGT
GCTGTGAGAGCGACTAAGTAATCGGTTGCTATGGTGGGCTCGGCATTTTCTGATGATGCCAACTCGTACGGGTATACATCGTCCATGATCACTCCGACAC
CAGCTACGAGAAGCAAAAACAAACACACACAGTGAGGTCTGATCGGCATATTCACTGCAGCTGATAAGATATAACGTACCGAGCAAGGATCGAGTGGCTT
CAAGTCGCAGCAATGCAACTGCTGTTCTCCGGTCAACCACTTTTCCCATGCATAGTGCATCGAAATCTTCGTCTCGAAAAATACGGTCCATTTCTTCGTC
CACATCGGTGTTCTCATTGCTGGTTGTCACGTCAGGTTCGGGTGTTTCCATTGACTCCGTGGCTGGCGGTGTCTCCCCTACCGATTTTTCACCTTCGGTA
GGCGGGGTGACAACTTTGCGGCGTTGACGAATTTGAAGCTTGCGATCAACTGCTCGCTGTACAGCCCCATCGAGAGACAAGTACTTTAGTCTTAGTCGTC
GCGCTAGCACTCGGGCAAGCCGTGTTTTGCCACATCCGGGTGGCCCCACCACTGCGACTCTAAGAGCTGGGAACGCGGATAGAGCAGCAGTAAGGGCTTC
TTCTGGATCCCAGTGCGTTGCACTCTCACGGTGAAGCTTTCGGCCTCGGACTGGAGTCGCCCCCGAGCCAATGCAACCTACGAGCTCCATATGTAGCCGC
TTTGCCGCGACCATGCTGTCTTCAGCGACGGCCATGGAGGCATCAGCAGCGTCAGTTTTCATTTCTTCTGCTGCATTGGCCGCGTTGCCATTCGCGCTGG
TCTTCTTCTTTGGAAAGGCTCGGGTGAGTGAGAATTTTCGAGGGTTATAGCTCAGTAGAAGCTGCTTGAGCGACATCTCTCGTTGATCAGGGGGCTGCAA
TCCCCGAATGCTTCGTAAGGAGTCGCTTGATGGTGGGAGCTTTTGCAGGAACGCATCGTTAGCAATCTTCGGGATTCGATTCAGGGGCCGAAGTACGAAG
CGATCCACTGTTTCAGCAGCAATGGTTTCATCTTGCTCTGGCTCACTAGTGGAAGGCGGCACAACCAGCTCTGCGATAGAGTTCCGCAGCTCCCGGAAGA
AATTCACGTACAGGGTGGCTGCGCTTTCAACAGGTAGAATAATCTCCGCAAGCTGCATGACAGCCTCACGAAATTGTTCACAAGACATGAGCTCATTGTC
CAGACTTGAGGCCCCTTTGGTGGATTCTCCGATACTGCCGGTGCCTTCTAAATCGTATTCCCAGTCACGCTGTGCCGCAGCGAGTGCGAGCGGATCAGTC
GACAACGGAAGCACCAAGGCTTTCGCAGCTCGGGCGAAAAAACCGACGTATCCCTCTCGGTTCAAAGCACAGGAGCTCATGGGCTTGGCCAGGTCCCATA
ACAGCGTCACTTCGCGAGCAACTTGTCCATTTGCTTCCCCACCGCTCACAGACTCGTCGCCCTCCAGCATCGCAATTCGTCGATTATGCCACAGCCGAAG
CAGGTTGACCTTGCCCTCACCTACACTGCGTTCCCGTTCATCTTCAGCGAAGAGGAAGTGCCGACGCATCGAGACTCTAGCGTGATCGATGTCTCGCTCA
AAGCTGGATGGTTTGTGAAGGATCCGCAATGGCGACTACTCGGAGGAACACGCCTAATGAAGACGAAGCAAAAAGGTTGGTCGGTTTCACAAACTTCCCA
TTTCTAAGGATCTTGCACTCGTCTAAATTATAAGCGTGCTCTACCGCTGTAGACACGAGTAAAGGTTTAGTTCGGCTTCTATGCTAGACTTCGAGATGTC
AAGGTGACTCGAGTAGACTCGAGCGCAATCTCGGCACTGGTCGTGCGCACTCGAGTCTTCTTGTCACCTGGGCGCTGCTGCTTCTTCATTAACTCGTCGC
CCTTCTTTTTGAACATGTTGCCGATGGATTTTCGTCGGGACTGCTGCTTGGTCACTGCAGCGTCCTGCACCACCCACGGGTGCTGCAGAGCCGCCTCCAC
GGAGAGTCTTGATTTGGGATTCACGTCGAGAAGCCCGGCAAGCAGGTCACAACACGCAGCTGGCATTTGCGATAGCAGGCCAGTCTCCTGGAGTGCGATC
GCTGAGCCGCGCTCAACCATTCGACGGAAGAGTCTGTCACTGTCAACCCAGACCCGGCGTACCAAAGCGCGCTTGGTGCACAGGGTCCACAGAATGACTC
CGAGTGACCAAGCGTCAGCCTGTCGGGCATCTTCCACTTCACAGCGACGCAGTAACTCTGGTGCAGCATACGCCTCCTTGGCCACTTGTAAGACTTGAAC
GTTTGGCCGGTCGAGCCTGAATCGCTGAGCGTGGCCCAGATCCCCAACTTTCACGACGCCAGACTCGGTGACGAAAACATTTTCCGGCGACAGGTCCAAG
TGGGCGATACCAGCGCTGTGCAGTACTTGCACACCGCGCAGCACAGAGCGGAACACACGACGTCTCCCCGCATCGGTGCAAGTCATCATCGAGGAGCTTT
GAGGAGAGACGCCGGCCGTTTGAAGGCGAAGCTCTTGCTGCATGATCTCGAGCAGGTCTCCGCGCGCGCAGTGCTCGTGCAGAAGGTGGAGTCGCTCTCC
TTGCAGGAAGTGCCGCTCCAAGTTGACCACGTTCTCGACGTCCCGAACCGAGAGGTGCAAGTCCAATTCCTTCAACGCTGCGGCGCTTGCATTGCGCCCT
TCGGGGGTGGAGGAGGTCATGAGAGTGCTCTTGTCGACAAAGAGTCGACCCGAAGCAGGGCACTCGACGAGATCCACGTACTGGAGCCTATCGAGACTTT
CTTGAATCCGCGAGCAAAGTGTCACCATTGCCAAAGATTAACGTACAGTAACAGTAGAGCGAGACTCCGCCACCCACGCAGCGTTTTTCAAAGTGAGCAC
AGCCTCCGACAACGATCTCCTATATTTACTTACCTTACCAGGTGGATTCTTTGCATTGCAAGTAACGAACGGCATAGCAGTTTTCCCCGGCCACCAGTTT
TCTGTCACACATTATGGCTCTGTAGAGCAAAGGTCTGACGGAAATGTGGTTTCCAGCTGTATGGCTGCTGCGATCACCCTCTCCCCACTAACATCCTGCT
TGTACTGTCTCGGCCGCGTGGGAAGTTGGCGTTCACCAAGGTGTGCGAAACTGCAACTTGCTTTCATTCTGCTGGTGGCACGTCATAGCCCAGGTGGTGA
TAATACTTAATCTTATTTGAACATGAGATTACTGTACTTGCCTCGACCGCCCTGCATCCACGTGAGAGCAATGGCGTGCGTGTTTCATACGTAGTGGCTC
AGCTCAACTCGTCGCACCTTTGAATTCATTCGCGGCGTCCCCTTCGCAAAAGTTGGTTACCACTAAGTCCATGGGTCGCCACGTAAGTTGGTTTTCAGTC
CATGCACTGGGACTTGTGGAGCTAAAAGGAATGGAGCTACTCAAGGCCAGTTGATGACCAGCAGCTCGAATCGACTAGGCTCCGTGAGCCCTAAGGTGAT
CCACATGGCATAGGCCAAGGAGATGACCTCTGTCAAAGGAATGTCGGTGTTGACGGGCTGCCAGTTGTTGCCCTCGATCGCCCAAAATGGGACTGATACC
TTAGTGCGAAGAAGCGCCCGACAGCTCCGTGAACCTTATTGCGTTATCTCTTGCGCGGAGAGAGGAATTCGTCGCGATAGACTCGACGCATGAGCATACT
GCGCCGGAAGCGAGACATTCGTGTCCTCGGTAACGCGGTGCAGGTCGCGACGCAGCCAAAAGATCCCGGCTGAAACGCCTCGCAGTAAGAATGACGATCC
CACCGACGCGCGAGTATCTCGAGGACTCGACCCCCGGGCACGCCAAGCAAGCAGCCTCGCCCGCCAAGCCCTCGGTAGATGCAGTGCTGGACTACAGCAA
CTCATACCTAGGAGACGACAAGTGCGCGGAGATCGTCGAGAAGTCTCGGCTTGCCAGCGTGCCAACGCGTTTGGATCTGCGTGGCAATTGCTTCGAAGCT
GGTGCTGCGCGGGCTCTGGCTGCGTTGCTGCGATCCTCGCATAATGTTGTGTCCATCAGCCTGGAATGGAACAATGTCGGTCTGCTGGATCAGGGAGTCG
AGGCCCTCGCTGGAGCACTAGAGGTCGACAAGCGGTTGCTAACGCTCGACTTGCGCAACAACAACATCGGCCCCGAAGGCGCCAAGGCGCTTGCCAAAGC
CCTGAGGTTCAACCGCACGCTGCGTCAGCTTGACTTGCGCTGGAATGAGATCGGGAATCCAGGCGTGTTGGCATTTCGAGAAGCGCTGCAGAGCAATCAT
TCGCTTGTGACTCTGGAGCTCATGGGGAACAACAGCAGCCTCAAGCACGTGGATGAAATCGAGGTCTTACTAGCGCGAAATCGTGCTTTTACAGAGATGC
CAGCGCCTTTGGCTGTTGATGCTTCGTGCCAGCCAGACGAGGATTCAACATCAAACAACGAAAGCCCCAAAGCTGCAGCAAATGACCAACTACTACTGCA
AGTGCTTGCAGAAAAGGAGGAATTGGAGACGGAAGTGAGCCTAGGCAAGCGAGAGCGTCAAAAGATGGTAAGGTGGGGTGCTCCAGTAAGCTGCACATAC
ATGGATCGACTTAACTTTCGTGGTCTGCCAATTATTTCCAGGTAGAGAAGGCAGAGGAACTCGAGATGCAGTTGCAACAGACCCGGAAAGACGCAGACAT
GGCCAAGGAAGATCGAGATCGTTATCAACAACGTGAAATCGACGCAAAGCGAGATGTCCACGAGCTGAGGATGCAGCTTGATGAGCTCGAAAATCGCAGG
AAGCTGGAGTTTGAAGAGTACCGGTGTGCACGAACTGCTCTAGAGCGTGAGAATGGAGTCATTCGAGAGAAAACGGGGCACATGGAGGCCCTGCGCAACA
AGGAAGCGGAGCAAAAAGACAGGCAGATATCCCTGCTGGAAGAGGCCAAATATGCACTCGACAACGAAATGCACCGCGCATCTCTTTCGATCAGGTGAGC
TGACTTCATAGTGCACACTTTGGTTTTTACTTTGAATCGTAGTGACTCTGATGCTCGTGTGCTCGCTCTTCAGGGCGCAACAGGAGGAAATCGGAAAGCT
ACAGAAGCAGCTACTGGACGCACAGCAAGAATATGCTCGAAAGGAAGCAAAGTTGCTCTCCGAGCACGAAGGAAGCTTGAGCGCAGCCCAGCGGCAACAC
GAAATGGTTGTTGGTTCACTGCAGACGCAGCTCAGCTATAATTCGACGCAACTCGAGACAAGCGAGCGAAGTGTCCGTGAACTCAAGGAAAAGCACGAGT
CTCTGCAAGCCAAGCTGCTACAGACACAGATTGACCATGAAAAGGCTATTGGAGACCTGAAGCAGCAGTGGGAGGCGGAAGTGCAGGAGCGCATCCAGCG
CTCAGTTGGCTCTGTGGAGGCCCAAGTGGCCGAGGTGAAGAAGGCGCGGAAGCATCTCGAGCGAGAGGTGGAGAAGCACCTCGACACGATCATTCAGCTC
CGCCAGGACAGTGTGTCACTGCAGCAAGCCAAGGATGCAGCTCAAAGAGAGCTCGAAACCACAATGGAGGCGCAGTCCAAGGCGCTGCAGGAGAAACAAA
CGCAGCTGGCTACGGCGATGAGCGAGAGAGCGCGATGCGAAGAGAAGCTGCAGCATCAATTGCGGAAGATGGAGGAGCAGGACGCCAGGCTCGTGCAGAT
GCAGGTAACATTCGACGAACGAATGCAGGCCCTGACCGCCAGCGCAAAGGTCGCGGCCGAGGAAAGTGCCGCCGCCTTGATGGAGAAGGCAGGAGCGGTC
GCGGCGCTAGAGGCCCAGGTGCTGCAGCTGGAGCGGGAGCTGTCCGCCCAGAACCACGAGCACGAGCGTCGCATTGATGACCTGGCAGAATCCTTTGGAC
GTTTCGTGCAGGAGCAGATCGCCACGGAGCGAGAACGCCGCAAGAAACGGCCCGCCGACGCGAGGTCCGACGCCTAGTTGGCACCGGAGCAATCGTACCG
AGGCTGCGGTTGCCACAGCTGCCCTCGCAGGAGTTCAGTGTCCTCAAGAGTTCGGACTCCGCATGGTAACTGCGGGTAAAATGAATCACGGGGCAATGGA
TGGCACGAGCGCTGCGATATAGGCATTCACTTGACCATGTTGAAGTGATTTCAATGAGACAATATGATTGGCAGTTTCCGTTGGACGGTCGCTGATTGGC
AGTTTTCCATCACAGTGGCATGGGCCGAAAATCGAATTTTTGTCGCACCATATGGTCTGGACGCATCAACCCAGCGGCAGCCATCAGTCACCTTACAATC
AAATATTGAAGGTACATCGGTTATTGCAGTGCAAAATGACTGGAAAAGGACGCTGAAAAGTATTACGTGCGTAGTTGCCCCTCTGCGACGTCCTGCACCG
GGCCAGCGAGTGCCGGAGGGGATTAGCCGACGCCTGAGCACGGCACGCTGGAGCCGCACGCCACCACAGCACGGTGCCGACCGCTGCCAGTTCCGCTTTG
TCCCCGGAGGGCTCACACGAACGAGATTGCCCCATCGAGATCTGGTAACGCTCGCGGCGGTCGCCCACCGAAATACAATGAAGGGCTCCAGCAGCAGCAG
CGTGCAAACGCTCATCGATCAGTTCGAACTCATGGCTCAGGCTAACGCAGAGCCGGCCGCTCCGCGCTCGTGGTCCGTAGCCGGATCCAAGAGGACTGCA
CTTCCACCGCAGCCAACGTCAGATAACTCCCCGATCAAGGAGATCATTTACCGCCTGAATACGCAGCGCGCTCGTGCCCGGTCGGATCCCGTACAGATCG
TGTGCAAGCCAGAGGAGACCCACGAGGTTGCCGAGCCTGCCGAAGAGCAGTCGCCAGAGGAGGAAGCAGAGAGCAAACCAGAGACCCCAATCAAGCCAGT
CGTCTACAAGAGCCTTACCGTTAAGACCCTGCAGTCCGACGACGAGGATGACGCCAAGACCCTCAACTCGTACGATGGCGAAAGCGATGCGGACTCAACG
GCGACCATCAAGTCCACGCGCTACTCGATCGTACCTAGCAGCCCGTCCTCGTTCTCCACGGCTTCTACAGGCTCCCTCGACTCGCTCCTTAGCTCGCTGG
ACATGTTCCTCCCCGAGTTCCTACAGGCATCAGGTGAGACCAGTTCAGAGACGTCGAAGATTGTCAAGCCCGCCGTCTATCGCTCAAGACGCTCCTCTCT
GCCGGAAAACCCGCAGTCGAAAACGACCTCCAAGCTGATCCCACCGACTGCATACCGACGAGCGTCGCTCACCGGGAAGTCATCTTCGTCAACGAAGGAG
ACCGGAATACTTGCAGCCCCCAAACCGCGTCGCTCCTCTCTCTACACGGCTAAAAACCCGGTACCAGTTGCCTCGACGCCCGCAAGGCCTCGTCGCGCCT
CGCTCTCAGCCACGATGGTGCCACCTGCCGTCAAGTCAGCGCGCCGTTTCTCGGAATCAGCCCGCGGAGCTCAGCCCGTGGATACGTCTCCACGTGCGAG
GACACGCTCGAACTCGACGTCTGTGCCTCGGTATATGGACTACGACAGCTCGCCACGTTTTGCAGCCACAAAGGCCCGGAACCTGGAGCGCCGCCGTCAG
CTGGAAGAGTGCAACCGCAACCTGGCCGCCGACAAGGGCAAGCAAACACACACCACAAGCAAAACCCCTCGGAGGCCGCGCACGCCGGAGTGGCAGGGCC
GCCTTGACCAGGTTCGCTCACGTTTGTTCGACTCAAAGGAGGACAACAAGTCGCGCGCACCCAAAGCGACATCAACTCGAAGGCACTCGACCTCCAGTCG
CGTCTAAAGGTTTTGATGCTGGTGCTGCGGCGCTCGTGCCCTCTGCGTATCTTTTCGCTTAGTTGAGCTGCATGTCTTCCTGTCCTACGCGAGCGCCGCG
TAACTTATACCATAAACTTAATAGATTTGTACACACAATGTCCACCGTCTTGCTTCTTGTTGCAGTGAACCTGCATAAACAGCTCGAACTCTCGAGAGTG
ATGGTCTCATACTTGAACTTTTCAGGTGCTGCATCTTGATTGGACCAGAGCAGGCAAACGTGGGGCCCCCGTTCTTTGACACAAAGACAAGAAAGCGTTA
ACCGTTCGTGTGCATTGCTCGTCCTGCCCGACCGCCGACATGACTGCTCCAGGCTTCATGCCCACCGGCTACAGCCTGGCTGCGAGCTACTACTGCCTCA
ATGCGAGCGGCGAGGTTGCCGACGTGGCCACTCCGGAGCCCCAGGAGCAGACGTCGACTGAGATTATTGACAAGGCCCCTGATTCTGAGCAAGTTTCTGG
CGATACAGTGCAAGTGCCGCGTATGCGTCTGAGTGAACTCAACTGGAAGAACCGCACGCGGTTCCTGGAGATGATGCAGCGCCACTCGTTCGTGGTGCTG
ACGGACCTGGGCGAGACGCTGGAGCAGACGCACGACCAAGTGCTGCAGGACTTCGAGATGTTCTTTACGAGCGAAGACGAGGACTGGAAGAACGGATGCA
CCAGCAAGCACATTTACCGGAATGAGCAGGGTAAGCCGTTCTGGTACTGCGGCTACGAACACACCAGCGTGCGTGACTGTTTCCGCGTGGCTTGTGGGGA
TATGTCGCGACTGGTGTGGCCTTCTCCCGAATTCAAGGACCACTGGCTCTCGCTGCAGCGGCGTATGCAGCGCATTTGCGACCGCGCGCTGAGCCTCACT
ATGGGCTACGACATCGAACCGAGCCACAAACGCTCGGATAAGGACTTCTCCGTTTGCTACGGCCTGCACTACCCGAACATCAAAGGCAGTGGCCAATCCG
AGACTGAGAATGTGTTTGAGCACATCGACCCCAGTTTGTATGTGGTGGAACCTGTGCCCAGTGTCGAGGGATTGGATGTGTACGACCCGCACTCGAAGCA
GTGGCTCAAGGCGGAGAAGGTGTGCGTCCCGGGTAAAGAGATTGTGCTCTTCTGTGGACACGCCCTGAATCGAGCTACAGAAGGCCGTATTCCAGGAACC
CTGCACCGTGTTCGACGCACCCCCGACAAAAGGTTCTGCATCATCTACGAACAGAAATACGAAGAATACTTCCTTTGAGTCTACCGGAGCTAGCTGGTGG
TACATAATGAGC