Description :
From Genome Similarity Track
Location :
Scaffold_480:5503- 7266
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_480-snap-gene-0.5Myosin

Sequence
1763 bases(100 bases per row)
ACACGTACACTGGCAAGATCTGTATCGCTGTGAACCCATATCAGTGGCTCAACCTCTACGACAAGTCGATCATGGCCCGCTTTAGCGACGGCAAGCGCGA
GGGAAAGGCCCCTcACGTGTACGCGGTGTCGATGGAGGCGTTTTTCAATATGCGGAACAAGCAtGAGAACCAGTCGATTCTCGTGAGTGGAGAGTCTGGT
GCCGGTAAAaCCGaGACGACCAAGATtGTCATGAGCCACCTCGCGACACTGGCAGAGAACTCCAACTCGAAGGTCAtCcAGCAGATTAtCCAGGCCAATC
CACTaCTGGAGTCGTTtGGtAATgCCAAAaCGGTCCGCAaCGAtAACTCGTcGCGTTtCGGTAAATTCACGGAGCTGCAATTtGGTGGCGACGGCAGGCT
TATCGGTGCCTTTTCGCGCACATACTTGCTGGAGAAGTCGCGTGTGACCACGCAGGCAGACAATGAGCGCAACTTCCAcATCTTCTATCAGTTGCTCAAG
AAGCGTGAACAGTTCCCCGAGCTCGATTTGAATGCGTTTGATGCATTCCGGtAcgTGTCAGGTAGCTCTCGGCAATCtgATGAGCCAGCTCTAGACGAAG
AAGGCGATTTGACACGCACTTGTGAAGCGCTCGAACTTGTCGGAATTGGCAGCGACTTGCAGAAGGAAATCTTCCAGATTCTTGCTGGcATTCTTCATCT
CGGTGAAACGGAGTTTTCTGTTCGCAATGGCGATGTTGATGCCTCTCAAATCGTTGACATGAAACCCTTTGAGACCGTTTGCCGCCTATTGGGTGTGGAA
TCTTCAGCTCTTGAGCGTGCTATCTGTAACCGAAATGTACATGTCGGACGTGAGGTGATTTTGAAACCAATGACTCGGGACCAGGCTACGGACTGCCGCG
ATGCATTGGCAAAGAGCTTGTACTCGAAGCTGTTTCTTTGGCTTGTGGAACAGATCAACGAGACCATTGGTGTGAAGACGAAAGACGCCGGCTCATTTAT
TGGTATCCTCGATATTTTCGGCTTTGAGCATTTTGAGAAGAACTCGTTTGAGCAATTCTGTATCAACTACGCAAATGAGAAACTGCAGCAGAAGTTCGTT
CAGGATGTTCTCAAGACGGTTCAATTGGAATACGAGGAGGAAAACATCACCTGGTCGCACATTCAgTTCGCCGATAACCAAGATGTGCTCAACTTGATTG
AGGGCCGACTTGGTGTGATTAGCTTTTTGAACGAAGAGAGTTTACTCGCTACTGGCACtGATGCCGCTTTTGCGAGCAAGCTTGGTGCTGTCATGGAGAA
CAATCCTCTTTTAGAAACTCCTCGACTCAACCAATGCGCCTTCACAATTTACCACTATGCTGGCAAGGTCACCTATGATGCGAATGGCTTCCTGGATAAG
CACAGAGATGCGATTCTACCGGACATCAAGCAGTGCATGAGCACCTCCACGTTGCGCATTCTGTCCAAGACATTCGAGGCTGATGCAGCGGCTCCTCCAA
CCGGCGGCTCGCTTTCACGTACAGCCAGCCGTAAGAAAATGCACGCGCAGCCGAAGCGAACGACTGTTGGATCACAGTTCAAGGAAaGTCTTGCAGAGCT
CATGGAGAAGATTAATCTCACTGAGGTCCACTATGTCCGCTGTTTAAAGCCAAACGGATCGAAAAGCGCGAATGCATTCTCtCACGGGGAAATCGTCAAC
CAGCTACGCTGTGCGGGTGTCATCGAAGCCATCCGTGTGTCTCGCAGTGCCTACCCAAGCCGT