Description :
From Genome Similarity Track
Location :
Scaffold_133:55022- 56477
Transcript NameFunction/comments
Physo_143247hypothetical protein

Sequence
1455 bases(100 bases per row)
TCGATGGTAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGG
CCACTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGGCCGATGGTCAGACAGAGCGCGTGAATCGC
GTCGTCGAGGACGTGCTCCGCAGCATTTGCGCTGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCGGTGCACG
CCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGA
AGCCGATTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGTTTTGTTGTCGACGCGTCTGAGTGTCTTACGACATGTG
CGTGACGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGAAAGTTATGAGGTCGGGAACCTGGTGTTGC
TTAATGCTAAGAACCTACCTACACATGCAGTGTCAGCCGTCTTCAAGACGAAGTTACGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGG
CCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGCAGATACAGATG
GAGGCACCGAGAGTGACGAGGTCACAGGCGCGGAAGCCGCGGTCGTCGAGGACGCAGTCGCAGGCGTCGACGCGGCCATCCACGTGGGCACCGCAGGCAC
AGGCGGAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGAGCCGCAGGCGCAGGAGACGCAGCAATCGGAGCCTGCACGCGGGCCAGGAGGTCGAGC
TGACCCTGAAGCACAGCCTACTGACGCTGTAGCTCCTCGAGCTCCCGGCCACGCTGCTCATCGCGATCCCGATAGTATCGCACCCAGTCCTCCAGGGCCC
CAAGGCGGTCCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGACCCATACGCGAATCAACGTC
ATGGATATGATCCCGAAGGCGACCGCCTGCTGCCGCACCTCCAAGAGCTCACTTTGAGTCGCAAAGGGCCCCACAGCGGCCTCCACCGGCTCTGCTCGAT
GAGCATGGGAATCTACATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTACCCTCACT
CCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGT