Description :
From Genome Similarity Track
Location :
Scaffold_242:5502- 8005
Sequence
2503 bases(100 bases per row)
ACTATACCGGCACATACACGTTCCCGACAGGACGTTGTTCGAAACAACATGGTTGGTTGTACTATGCATGTTGCACTCGACCTAGTCGATGCATGTTAAC
AATTGCTCATGCGAGCGAGTGATATTCCGCTTACAGAAGTGAGCACTCCGATTGGTATGCTATGGGAAGGGCTGGTTATGTCCCAAGGACTGTCCAACGC
GCCGGCTACGTCTAATCGTTTGGTGACGCAACTTTTCTGTCCCCGTCGGGATTATGTACATACATACTTTGATGACATTTTTGTCTATAGTCGTGCCGAA
CAGGGTCGGTCAGATGTTGACAATCACATCGTACATCTGCTGGCAGTACTTAAGTGCATGCGTCAAATAAATTGTATGCCAATGCGTCTAAATGCAGAGA
AGGTTTCTTTTTAGGATGTTTCATCGCAAAGCTCGGCCTTAGAGCGGCCCCGCTAAGGTAAACGCTATAGTTGACTGGCCGATTCTTAACAATTAAAAGG
ACCTGCGTAATTGGCTCGGCGTTGCCAATTACTTACACAAATACAGCGAAAATTACGCTGATGAGGCTCGGCCATTAACAGATCTCCTTAAGAAGGACAC
AGATTGGCGCTGGGACAACAACCATGCTGAAGCATTTCGGGCAATAAAGGAGAGTATCCTCCATACTCCCATTTTGGCGTTGCCAAATTCCGAGTACCGT
TTTAGTGTCGTCTGCGAAGCATCCGACTTTGATATAGGCAGCGCCTTATTGCAAACAGATGCTGAAGGACGTGAGCGAGCTATCGCAATTGAATCTCGTC
AGCTGAAAGCTGCTGATAAAGGACTACCCGTTCATGATAAAGCTTTACTTGCTATGAAGTATACTCTCGTCAAATTTAGATTCAACTGCTTGGCTCAAGC
CATCCGTCGTCGACACGGATCATGCGTCGTTACGCAAGGCTACACAGTCGCCTCACCTCTCCTAGAGAATGGCTCACTGGATTTTCTTCTTTGCTGAATA
TAACTTTGAGGTGAAGTAAACGCCGGACAAACAGAATGTGTTAGCGGATACCCTCTCTCGCCGACCCTACTATGAGATTGCTCATATGACGACTTTTTCG
TCTCCTATTGAGGATATAATCTGCAAGGCATATTCCCGAGATCCTCAATGTGTGGCATAGATTCATTCTCTTGGAAGTGACGAGTATGAAGACTCCGACA
GTTCTTTGCCTGCACGGTAACGTGCCAGCCTACATCGATATTCCATCGATAATGGTATCTTGTGCTATCGCACGGATGTAACGGATACTACTCGTGTCGT
CTTACGTCACGATGAGAATTTAAATTATCAAATCCGCTTTGAGGTGCATGATACTACTCTCAGTGGGCACTTGAGCCGGGAAAAGACTTACAGCTCTGTG
AGTCAAACAAAAATAAAAAAGCGTTTTATTTAATATTTTTATCCCAATGATTATTAAATTTAAATAATCTATACACTACACTATTAATACTGGTGGCCCA
AAACTCTACAAATGAGTGAGCATATACGTGCGCACACGTGAAAAGTGCCAACGGGTCAACCCTCGGCACATTCGGCTGCGCCGCTTGCTAAACTACCTGT
ACCTATTGGGTTCTGGGAGTCCATATGTATAAACTTTGTGGTTAGTCTTCCTAAAGACAGTGACGACAATAACAGGATTGTGGTCTTTGTTGACTGTTTG
AGCATGATAGTAGTTCACTTAGCGGCTGTGAAGGACTTCATGGATGGTGGAGGTACAGATAAGCTGTTTATCGATCGTGTGTTTGTCAGCAGGGGTTGAC
AATGACGATCATATAGGATCGAGATCCTCGCTTCATTGGCAATTTTGGACGTCCATATTCAAGGTGCTTGGCACACAATTGAATATGTCTACCACGGACC
ATTCGCAGAACGATGGTCAAAATGAGCGAATTAATCGCTTCATCGGTGTAGTTCTTCGCAGTGTTTTTGCAACACCGCCTAAGACTTGGAGCTCGATGCT
CCCTGTCGTTGATTTTCGTTGAGCAACGCCTTTCATTACTCTACCGGATTTTACTCCATTCTAATTGAATAGACTCGCACACCCACGCGTTCCGCTCACC
CTACCACTGCGTGGTTCTGGGTTAGAAGGGTTTCCGACAAGCTTGCTGGTATTATCCATACCACTATGCAGCAACAGGTGATCGAGTTTATCGCGACGAG
CCTTAATGTCTTACGCCACGTACGTGATGCAATGGCTTATAGACAAGATAAACAAAAATAACAAGCTAACTCTAAAGGCAGATGATGTAATGATTATTAT
AAAGTTGGAGATCAAGTCTAACTAAACGCTAAAAGCCTACCTACGAGTGCAGTGTCTGCCGTCTTCAAGACAAAATTGGGCCCGCGCTTTATTAGGCCAT
TCACGTTCATCGGTAAGAAAGCCTTGCCTATATGGTAAATCCTTCGCGCAAGCTCGCACACACCCAGTGTTTTACGTTGGCTTGCTAAATCCATATCATA
ATC