Description :
From Genome Similarity Track
Location :
Scaffold_969:5502- 6639
Sequence
1137 bases(100 bases per row)
GCCAACTACTTGCACAAGTACACCAAGGACTACGCGAAGTTTATCCAGCCACTGTCGTCGCTGCTGAAGAAGGACACCACGTGGTCGTGGCGAGAAGAGC
ACCAAGCCGCATTTGGCTCGGTGAAGAGGAGTCTGTCATCCGCCCCTGTCTTGATGCTCGCAGACGATTCGAAGCCATTCCACGTCGTCTGCGACGCAAG
CGACTTTGCCATCGGGTGTGCCCTGATGCAGTTCGACGAGGAGGGTCGTGAGCGGGTGATCAGCTACCAGTCCCGCCAGCTCAAGCCGGCGGACCAGTGC
ACGACAGGGAGCTCCTCGCCATGCGCTACACATTGGTCAAGTTTAGGGTCTACCGGCTCGGAGAGCAGACGTTTGCGGTCTACACCGACCACGCATCGCT
GCGAACTGCGATGAAATCCCCGCATCTGTCCCAGCGCATGGCCCGCTGGCTGTCTTTCTTCTCCGAGTACAACTTCGTGGTGCACTACAAGCCTGGCAAG
AACAATATCCTCGCCGACGCGCTGTCTCGGCGTCCAGACTACGACCCACGTGAAGGCCTCGAGCGCCAGGCAGCTGACGAAGATGATGAAGACGCGTGTG
CGACGTGTGTGACGTCGGGGTTGAACCTGACGAGCGGCGCCCCCAAGATGCCGCTTCGGGACAAGATCGCCGCAGCGTACGAGCATGACGCGCAGTACGC
CAGCATCCTGGCCCACCTCCGCTCTCCATGCGAGGCGACATTGAAGGCTCTGTCGCGCTCGACCCGCAGCCACGTCGAGCGATATCGGCTTGATGGCTCC
CTGCTGACGTACACCATCGACCGATTCGATGCCCTGAGAGTGGTAGGGCCGAATGACGAACACCTTCGCGCCCGTATCATCCATGAGTACCACGACGCTC
CGATCGGGGGTCACTTGGGACGCGAAAAGACCTTCGCGGCGGTGGCGCGAGACTTCTTCTGGCCCCACTTGTACAAGTGGGTGCGCACTTGCGAGATCTG
CCAGCGAGTAAAGCCCCCGCCGTCATCGCAGGCTCCGCTGCGTCCACTTCCGGCCCCCACGGAAGCCTGGCGCTCCGACTCGATGGACTTCGTCTTTGGT
CTTCCACCCGACTCGAACGGGCGCACGGGAGTCCTCG