Description :
From Genome Similarity Track
Location :
Scaffold_37:550136- 553424
Transcript NameFunction/comments
Phyin_T30-4PITG_15392Leukotriene A-4 hydrolase-like protein
Phyin_T30-4PITG_15393Eukaryotic translation initiation factor%2C putative

Sequence
3288 bases(100 bases per row)
CACTGCAGGCCGCTGGAGGCGTCGGATGTGGTGTAATCCACACGGATCTTCGTGGCGTGGCTGGGCACGGACACCACGAGTGCGCGGCCGAATACCGGGT
GCTCCTTCTCGGCCAGAGCGAAGGGCGTCTCCTTGCCGTCTGCATAGACTTTGGAGACGCTCAAATGGTGCGTGTCCAGCACCACAACGGAGGACGTGGC
GGTCGAGGCGTGGTGGAACGTGTACTCGGCGTATCCCTTGAGTTGCTGGGCTGCGAAGTCCAGCGCAATGACCCAATTGAGATGCGTGAACGTCACCTCG
TCCAGGTTCGAGTACGAATGCGAGCGAAGGGGGCGCTCTTGATCCATTTTCACTTGCGATTTAGTGGGGATATTGAACAGGGAGTATTGACGAATGAGAG
CTGTGATGTGTGTCCAGAGATCCGCACAAGTTATTGTGGAGGGGAAAGTGGGATTAGTGACATCGGAAACGATTTACAGAGCGTAAAAGTGTCGCATAGT
CGAAAAAGAGTAGGGATTCAGGAAACGCGCTGTTCGTCTACATGGCCTGTGGTTTGGTTCCTTTTAGGGGGATGATAGTCTGCTGCGGCTTCGTTTTGTC
TGCTAGCAGCGCTAGTCCACACGTACGGCGATAACATATCAGCAACCAATTGGAAATGGCCGATTGCATACTGTGCACCTTACTTTCAAAACAAAGTTTA
AATTTCATTACTATAAGCTACTTTAAGGTAAGAAGATATTAATACATGTAAATCGGTGGTATTTAGAGCTATCTTAAGCTTGAAGATAAATCGGAGGCAT
GGGGTGCCATAATGTGCAATTTCTTGTGTGGTGCAGCGTGCCTGTGTGTGTGTAGTAGGTTTTGTGGTCTGGGTGTGATTTTGTCAGCCTTTGCTAATTC
TTTGTCTGTTTTAAATGTGCTCTCAAAATTTAGGTTGGCTTTTTAAAGCGTACCATTTAGAAGGTACACTTGGCTTGGCTACGGGATCGAATAACCGTAG
GCACACGGTCCTCACCAATCAAATTCCATTTATCCTCTTCCTATTGGCCAAAACACTTTTGACCAATCCTCTGCCATTATCGAATTGGTCTGGAGGCGGA
CAGCCAAGCATTATCATCTTCTCAGGCAGGAAGAGCGACGTCCGCTTCTCTCCATCCCGAGGCCCCGTTCAAGCACCTGCGCAAGTTGTGCGTGTGTGCC
TCCATCATCTCCTCCACCGCAAGCGTTGAATTTGTCAATAGAAACCTCGTGCACAGCTCAGCATCATGACAGAAGCGCAGCCAGAGAACCGCGCCACATT
GGACGCCAAGACGAAGCTCGACGCTGCCGGCAGCTCCTCCAAGCTGCGTCCTACTGCCAAAGAGTTCGTATTTAACACAGCGGCTCCTGTATGGACGCCC
TCGTTTGTGGCGTCACCGCCGCCCGCTCCTGTCGCCCCTGCCGCTCCTCCCGCCCCTGCCGCTCCTCCCGCGCCTGCCGCGAAGAAGAGCCAGCTCAAAC
TCACAGCCAAGCCCTTCGTGCCGTCTTGTACGCAAACAACTGCGATGATACGTACACAAAGAGTATGTACTAACTTTATTTAACATGTTGCTACTCTAGT
TATGGCCCCAGCGTTCGTGCCTGCATCGCTGAAGACGCCCGAAGTGGAGAACGTGGAGACGGTCAAGGAGACGGAAGTGACGACGCCCACGTCAGAGCCT
GTGTCGACACCTGCGACGTCAGCGGCTTCTTCCAATGCGTCGGAGCCTGAGACGGAGAAGGAGGAGAAGCTCGAGGAGGCCTCGGAGCGAGAGGAGAAGC
AGAAACAGGACGTGGATGTCCAGGAGGTCGTCGAGGAAGCGACCGCCGAGCCTGAGGCCGAGAAACCCGAGGTTGTGGCCGAGCAGGCGGTGATCGGAGC
GCGTATTATCTACACTATCAAGCAGCTGCTAGAGATGGAGCCGGACGTGGAGCTGTGCGTCATCCCGGAGCGTGTCAAGGGTATGGTGATCGCTGCCGAC
AAGACCACGAAGGCGCTATCGGCCCCTGCGCCTGAAGTCCCGGGTAAAGGCATGCGTCGTAATGACTCGTCTCGCTCTCTGGGGCGTCACGGCAGCAGCG
GCAACTTCAGTGAAGGACGCGGACGTCGGGAACGTGGCGGTGGACGTGGAGGACGCGGCGGACGTGGCCATCACGACACTGCACCCGCACTGGAAGACTG
CGCGCCTCTGGATATCAACGAGGAGACGCGCTGGAAGCCTTCGCACGCCAAGTCGCGTCTGGACGATCCTGTGGAGACCGCCGAGGCGTCTCTGAAGGAA
GCCAAGTCGATTCTGAACAAGCTGTCGATTGAGAAGTTCGACAAGCTGTCGGATCAGCTGATTGAGGTGGCTGTGCGAGGCTTGGAGGTGCTCAAGGGCG
TGATCGAGATGGTGATTGCCAAGGCGCAGATGGAGTGGCACTTCGCCACCATGTACGCGGAGCTGTGCGCCAAGATCGCGCAGACGGCCATGCCGGCGAT
CACTCTGGAGGAGGGACAAGTGGCGACGGACACGCATAAACTGTTCCGGAAGCTGCTGCTGCAACGCTGTCAGAAGGAGTTCGAGGCCAAGCCGGAGCTC
GAAGGGCTAGAGACGCTATCCGAAAACGAGCGACGCGAGAAGGAGCTCATCATGAAGCGCGCGTCGCTGGGCCACATCCGCTTCGTGGGCGAGCTCTTCA
AGCAGCGGATGCTGAGCTCGCGCATCATGCACGAGTGCGTCGGCATCCTGTTTGGAGACACCGCAGCGCCTGACGAGGAATCGCTCGAGTGTCTGTGCAA
CTTGCTGAGTACCATCGGCCGGGCGCTTGAAGCCAATGCGAGAGAGAAGGCCGAGTTGAACCACATCAACGGATACTACGCGACTATCAAGAAGCTCAGT
GGCGAGTCCACGCTGTTGTGTACGCGTGTGCGCTTCATGCTGCAGGATCTGCTGGAGCTGCGCACAAACCGCTGGGTGGCTCGTCGTAAGGAGACGAAGG
CCATGACGATCGCTGAGGTGCACGCGGAAGTCGCTCGCGAGGCCAAGGAGAAGGAACGATCCAGTACCACCAAGTCTGGCGGCCACGCGCGTCTACAGCG
CAGTCAGTCGATGAACTTCACTGGCTCCGCGGGCTCGAACGACCGCCGACGTGGCAGTGGCGGAGGCGCGTCGGCGGCCTGGAAGGCTCGCACGTCGGCG
TCTTCTACAGCTCCGTCTAGCGCCCCCACAGTGGACGCTGATGGCTGGGAGACGGTGACGGGTGGAGCACGTCCCAAGGGGCTGAAGC