Description :
From Genome Similarity Track
Location :
Scaffold_2634:550- 2839
Transcript NameFunction/comments
Phypl_g15271reverse transcriptase

Sequence
2289 bases(100 bases per row)
CCACAAGATCGCGCTGtaggcgccgccgccgcgcttaACAGGGGCTGATCAGTCAAAGCTCACCACAAACAGCTCCTCGCCCGTCCCCACGGTCGGGATC
GGAGCTTGGATCTTACGTCGTGGCTCCTTTTTGGGTGCGATCGCAgtcagcgcctcgtccaccttggaTCGGGGCGTGATACTCGCTGCGATCGCCCCTA
GAATCTCGTCTTCCCCTTTCACGCACTTCACGATCTCGAGCGTCCAAGGTGATAGGAGAGCGGTCCACTGTCCAAGACGTCCCTGGAACCCCGGCGATTT
GAAGAGCCATGCCAACGTGGAATGCCTAGTCAAGATCCGAATCTGACGTCCCACCAGCATGTTGTAGTTCAGATCCAAGATCCTCAAGAGGATCAATact
tccttctccaccacgtttTAATTCAACTCATTCGACTTGAGCGTTCTGCTTGCGAACATGACAGGGTGGTATATTTGTTCGTGATCTTGCACTAAAGCCG
CCGAGATCGCCCACTCACTGGCATACACGATCACCACTGCCTGGCGATCGGGGTCAAAGTGACGTAAGATCGGCGTCGTGGCTaccttcgccttcagcgt
ctcgaagGCCTGTTGCGCTCGAACCCATCTCTCATCCGCGGCCTTCGATCCCGGCATTACGGGGTCCGATCCGGTCGTGTTAAGCGTCCTGGGATCGGGA
TTCGTGGGATCACGGTCAAGCAACGATCGATCCAGCAACTGACGGAGATCTCGCCGCTTTCGCAGTTCAGCGAAGTCCACCTCACGTAGCTCGTACAGGA
CCGCGGCATAGATCGCATAGTCCTCGATGAAGCGGCTATAGTAATTCAAACTGCACAAGAACGACTGCATCGATCGGAAAGATTCCGAAAAATGTCGATC
AGTCAGTGCTTCCAGGTCTTTTGGGCGAGCTTCCAACCCACCAGGTGACACTTGGTGTCCCAGATAGTCCACTTTGTCCAGCCCCCCAAAACTCTCCACC
ATGCTGATAGACAGATTCCACTCGTAACATGCGTCCAACAGATCTTCCACTCGATCGCATAGCTGATCCCACGATTCGGCAGTCACCAGGATGTCATCGA
TGTATGATCGACGTCCCAGCACTGACGGTTTACCCGGATCGACGGGTTCGCCCGCAAGTCCGTCAGCTGTCCATGGTCGCCCGAGCGGGAGATCTTCATA
AACCCATACAACGCGTTATCCACCAGTCGCTGGTAGATCTGCGGTGCGTTCTTGAGACCGAACGGCATTCGGTTCCACTCGAACAGTCCAAATGGAGTGA
TGAAAGCCgagctcgctcgagctcggtCCATCTTCGTGACCACCCAAAACTCACTAGCCATATCCAACGAGCAGTACCATAAGAACTCGTCCAAGCCAAT
CGTTGATCAGTGGCATCGGATAAACCATCAGCCGCGTAAGTCCGTTCACCAGTCGGTAATCAATGCACAGCCGCATATCCACTCCGTTCTTCTTGATAAT
GATCACGAAGGGCTACGTCGAGTGTCTAATGATCTTGGCCGCCAGAAGTCCCTTGAGCAGATCCGACACCTTCCCTCGGAACTGCAGGGCGATCTTCCGC
ACCCGTTGCGCGATAGGCCTTGCGTCACCTACGTTGATATCACAAACAACGCCTCTGGCGGCTGGGGGCAACGCATTGCCCTTGCCGATCAGGAGGTGTC
GCCTCTTCCAGATCATTCGACGTAGCCAGTCAATCTTTTCAGGGGTATTATGCTTCGGATCTCCCACTTGAATATCTTCGATCGTCACTTCGTCCGTCGC
GTTGGAGCTAAGTTCCGGAAGCACAgccagctcttcttcgacatcTTCGGCCAAAAGTCGCTTCCTTCATGATAGAAGATCGATCCATCGCCTGACGGGT
CCTCTGTTCCGACACGTTCTTGATCCGGTCGGTCTTTTCTCACCGTGTGGTCCTGAGTTGAGTCTTGATCGCTTACCACATTTTTGGCAAGTCAAACGTT
TCCAGCAGTCCAGGCCCGTATGCTTACGGGAACCACAATACAAACAGCGACTGCGATCCGTcgggaggcagcagcgatctGCGACCATGGGGCACCTGAT
CTGTCGCGATCCAACCCGGTGGTAACCGATCTGCCTGGGCTGTCTCGCTCCCTGCCGGAGGTGGAGTAGCTTCTGCCGATGCAAGGTAGATCCGACGTAG
ATCGCCCTCCGAATCAGATCCTCCGGATCCGTCCAAGCTGGAGTCCGATCCCGACGGAGGAAGCAAATACTGGATCGCGCGTACCGCTC