Description :
From Genome Similarity Track
Location :
Scaffold_4079:550- 2542
Sequence
1992 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCCAAGCCTTATAGCGTCGTATGCGACGCGTCCAACTTTGCTATCGGCAGTGCATTGATGCAACTAGATGGCGAATGTCATGAACGAAT
GGTCTCGTACCAAACTCGCCAGCTCCAGGCTGCGGAAAAGGGGTGTCCAGTCATGACAAGGAGTTGTTGGTGTTAAAGTACGACCTGGTGAGTTCCGTCT
TCGCCTTCTCGACTCGCTGCTATTTGTGGTGTACACCGATCACCCGTCCCTCCGGACCGCGACACAGCCTCCCCACCTGCCACCTGTCGCCGCGAATGGC
TCGCTGATTGTCATTCTTTCAGAATGCAGCTTTACTTTGGAGTACAAGCCTGGTTGGCTCAACGTACACGCGGACGCCCTGTCCCGCCGTCCGGATTATG
AGATGGATCATCTCACATCAATCGCATCTGGCGTGTACGAACTGGTTCGTGACGCGTCTGGCGATGACACCCAGTGCTGAACGATCCTTCGCGCTCTCTT
GTCGACTTAAGCTGTGACACGTCTGTCTCCTTGCGCGGACTCCATCGATACTCCGTCCAAGACGGTCTCCTGATGTATCAGGTCACTCCTGGTGAGGATG
GACGTATCGTCGTCCCGGCAGATGAAGATCTGCGATACGTCATCGCGTACGGCGCCCACGACGCTCCGGGTGCGGGGCACCTTGGTCGAGAGAAAACCTA
CTCTCTCCTCTGCACCAGGCTCTGGTGGCCCAAGATGTACAAATGGGTCTCGCGGTACGTCCGCACGTGTAACATATGTCAATGAGTGAAGCCAATCCTA
CACACGCAAGCCCCATTGCAGAGTCTACCAGTCCCCAGCGATTGCTGGTGCTCGGTGAGCATGGACTACTTCTTAGGCTTGCTGCGAACGGCGGCCGGGC
ACGATGGTGTGCTGGTCTTTGTCGGCCGTCTCTCCAAGATGGTACATCTTACACCGGTCTCCGACACGTGCGCAGGCTCTGACTGTGTCCGACTTTCCGT
CGATGGGGTTTCCGTCTTCAAGGCCTCCCCGAACATATCGTGTCGGATCGAGATCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAGTCTTTTCCACATCTTGGGAACAAGACTCAACATGTCGACAACGAACCATCCGGAAACCGACGGTGAGACCGA
GCGCGCCAACCGCGTTGTCGAGGATATCCTCCGCTCTTACTGTGCAGAGCATCCAGGATCCTGGCGCGACTCTCCCAATGGTCGAGTTTGCAGTGAACAA
CGCGGCCCACGCGCCGACAGGTCTGTCACGGTTCTACATCAACGGGCTTCGCCATCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTAACTCAAGACGGCTGAGCGACTGAAGCTAGACGAGTTCATGTCGACTCGCG
TGAGCGCCGTCACACGCGTCTGTGACGCCATGGCGCAAGTGCAGGGCGTTCAAAAGGAACAACCTGACAAGAACCGTCGCAAGAACACCAATATGTTCAG
ATAGGGCGACTAAGTGTTGGCCAACACGAAGAACCTGTCTCCGCAAACTGTGTCTAGCTTGGGCAGCACGAAGCTGCTCCCGATGTATATCGGTCCGTTC
AAGGTCTTGAAGAAGACTGGTAACTCGTACCGGGTCGACTTACCCAGCTGGATGCAGACACACCCACGTTCTACGTCGGCTTCCTCAAGCCGTACCTTCG
TCCTGACGAAGCGGACGGTTCGAGCACCGAGGATGACGACAACGGCTGTGATCAAGTTGATCGTGTTTCGCTAGCTATGCGTGACAGCTCAC